ID: 903276541

View in Genome Browser
Species Human (GRCh38)
Location 1:22225694-22225716
Sequence TGAGCAGCCCAGTTTTCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903276541_903276547 29 Left 903276541 1:22225694-22225716 CCGGGTGAAAACTGGGCTGCTCA No data
Right 903276547 1:22225746-22225768 TGCTTTCGAGGTTATAGGCCTGG No data
903276541_903276545 17 Left 903276541 1:22225694-22225716 CCGGGTGAAAACTGGGCTGCTCA No data
Right 903276545 1:22225734-22225756 TAGGATGAACACTGCTTTCGAGG No data
903276541_903276543 -9 Left 903276541 1:22225694-22225716 CCGGGTGAAAACTGGGCTGCTCA No data
Right 903276543 1:22225708-22225730 GGCTGCTCAGGAGTCACATCTGG No data
903276541_903276546 24 Left 903276541 1:22225694-22225716 CCGGGTGAAAACTGGGCTGCTCA No data
Right 903276546 1:22225741-22225763 AACACTGCTTTCGAGGTTATAGG No data
903276541_903276544 -2 Left 903276541 1:22225694-22225716 CCGGGTGAAAACTGGGCTGCTCA No data
Right 903276544 1:22225715-22225737 CAGGAGTCACATCTGGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903276541 Original CRISPR TGAGCAGCCCAGTTTTCACC CGG (reversed) Intergenic
No off target data available for this crispr