ID: 903276544

View in Genome Browser
Species Human (GRCh38)
Location 1:22225715-22225737
Sequence CAGGAGTCACATCTGGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903276541_903276544 -2 Left 903276541 1:22225694-22225716 CCGGGTGAAAACTGGGCTGCTCA No data
Right 903276544 1:22225715-22225737 CAGGAGTCACATCTGGCTGTAGG No data
903276536_903276544 20 Left 903276536 1:22225672-22225694 CCAGTTTGGAATAGGGTGTATGC No data
Right 903276544 1:22225715-22225737 CAGGAGTCACATCTGGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903276544 Original CRISPR CAGGAGTCACATCTGGCTGT AGG Intergenic
No off target data available for this crispr