ID: 903279748

View in Genome Browser
Species Human (GRCh38)
Location 1:22243821-22243843
Sequence GTGAAAACTGAGCCCCCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903279748_903279754 -2 Left 903279748 1:22243821-22243843 CCTCCCGGGGGCTCAGTTTTCAC No data
Right 903279754 1:22243842-22243864 ACCCCAGGGGAAATCTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903279748 Original CRISPR GTGAAAACTGAGCCCCCGGG AGG (reversed) Intergenic