ID: 903279944

View in Genome Browser
Species Human (GRCh38)
Location 1:22244750-22244772
Sequence AAAGGCTCAGAGGGCAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903279944_903279955 25 Left 903279944 1:22244750-22244772 CCCTGGCTGCCCTCTGAGCCTTT No data
Right 903279955 1:22244798-22244820 TTACTGATAACCAGGGGAGAAGG No data
903279944_903279953 18 Left 903279944 1:22244750-22244772 CCCTGGCTGCCCTCTGAGCCTTT No data
Right 903279953 1:22244791-22244813 GTATGGGTTACTGATAACCAGGG No data
903279944_903279956 28 Left 903279944 1:22244750-22244772 CCCTGGCTGCCCTCTGAGCCTTT No data
Right 903279956 1:22244801-22244823 CTGATAACCAGGGGAGAAGGTGG No data
903279944_903279949 1 Left 903279944 1:22244750-22244772 CCCTGGCTGCCCTCTGAGCCTTT No data
Right 903279949 1:22244774-22244796 CTGCTGTGATCGCCTCTGTATGG No data
903279944_903279957 29 Left 903279944 1:22244750-22244772 CCCTGGCTGCCCTCTGAGCCTTT No data
Right 903279957 1:22244802-22244824 TGATAACCAGGGGAGAAGGTGGG No data
903279944_903279952 17 Left 903279944 1:22244750-22244772 CCCTGGCTGCCCTCTGAGCCTTT No data
Right 903279952 1:22244790-22244812 TGTATGGGTTACTGATAACCAGG No data
903279944_903279954 19 Left 903279944 1:22244750-22244772 CCCTGGCTGCCCTCTGAGCCTTT No data
Right 903279954 1:22244792-22244814 TATGGGTTACTGATAACCAGGGG No data
903279944_903279950 2 Left 903279944 1:22244750-22244772 CCCTGGCTGCCCTCTGAGCCTTT No data
Right 903279950 1:22244775-22244797 TGCTGTGATCGCCTCTGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903279944 Original CRISPR AAAGGCTCAGAGGGCAGCCA GGG (reversed) Intergenic
No off target data available for this crispr