ID: 903279946

View in Genome Browser
Species Human (GRCh38)
Location 1:22244759-22244781
Sequence CACAGCAGCAAAGGCTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903279946_903279957 20 Left 903279946 1:22244759-22244781 CCCTCTGAGCCTTTGCTGCTGTG No data
Right 903279957 1:22244802-22244824 TGATAACCAGGGGAGAAGGTGGG No data
903279946_903279952 8 Left 903279946 1:22244759-22244781 CCCTCTGAGCCTTTGCTGCTGTG No data
Right 903279952 1:22244790-22244812 TGTATGGGTTACTGATAACCAGG No data
903279946_903279955 16 Left 903279946 1:22244759-22244781 CCCTCTGAGCCTTTGCTGCTGTG No data
Right 903279955 1:22244798-22244820 TTACTGATAACCAGGGGAGAAGG No data
903279946_903279956 19 Left 903279946 1:22244759-22244781 CCCTCTGAGCCTTTGCTGCTGTG No data
Right 903279956 1:22244801-22244823 CTGATAACCAGGGGAGAAGGTGG No data
903279946_903279954 10 Left 903279946 1:22244759-22244781 CCCTCTGAGCCTTTGCTGCTGTG No data
Right 903279954 1:22244792-22244814 TATGGGTTACTGATAACCAGGGG No data
903279946_903279953 9 Left 903279946 1:22244759-22244781 CCCTCTGAGCCTTTGCTGCTGTG No data
Right 903279953 1:22244791-22244813 GTATGGGTTACTGATAACCAGGG No data
903279946_903279950 -7 Left 903279946 1:22244759-22244781 CCCTCTGAGCCTTTGCTGCTGTG No data
Right 903279950 1:22244775-22244797 TGCTGTGATCGCCTCTGTATGGG No data
903279946_903279960 25 Left 903279946 1:22244759-22244781 CCCTCTGAGCCTTTGCTGCTGTG No data
Right 903279960 1:22244807-22244829 ACCAGGGGAGAAGGTGGGTGGGG No data
903279946_903279949 -8 Left 903279946 1:22244759-22244781 CCCTCTGAGCCTTTGCTGCTGTG No data
Right 903279949 1:22244774-22244796 CTGCTGTGATCGCCTCTGTATGG No data
903279946_903279958 23 Left 903279946 1:22244759-22244781 CCCTCTGAGCCTTTGCTGCTGTG No data
Right 903279958 1:22244805-22244827 TAACCAGGGGAGAAGGTGGGTGG No data
903279946_903279959 24 Left 903279946 1:22244759-22244781 CCCTCTGAGCCTTTGCTGCTGTG No data
Right 903279959 1:22244806-22244828 AACCAGGGGAGAAGGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903279946 Original CRISPR CACAGCAGCAAAGGCTCAGA GGG (reversed) Intergenic
No off target data available for this crispr