ID: 903279947

View in Genome Browser
Species Human (GRCh38)
Location 1:22244760-22244782
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903279947_903279952 7 Left 903279947 1:22244760-22244782 CCTCTGAGCCTTTGCTGCTGTGA No data
Right 903279952 1:22244790-22244812 TGTATGGGTTACTGATAACCAGG No data
903279947_903279957 19 Left 903279947 1:22244760-22244782 CCTCTGAGCCTTTGCTGCTGTGA No data
Right 903279957 1:22244802-22244824 TGATAACCAGGGGAGAAGGTGGG No data
903279947_903279954 9 Left 903279947 1:22244760-22244782 CCTCTGAGCCTTTGCTGCTGTGA No data
Right 903279954 1:22244792-22244814 TATGGGTTACTGATAACCAGGGG No data
903279947_903279950 -8 Left 903279947 1:22244760-22244782 CCTCTGAGCCTTTGCTGCTGTGA No data
Right 903279950 1:22244775-22244797 TGCTGTGATCGCCTCTGTATGGG No data
903279947_903279958 22 Left 903279947 1:22244760-22244782 CCTCTGAGCCTTTGCTGCTGTGA No data
Right 903279958 1:22244805-22244827 TAACCAGGGGAGAAGGTGGGTGG No data
903279947_903279956 18 Left 903279947 1:22244760-22244782 CCTCTGAGCCTTTGCTGCTGTGA No data
Right 903279956 1:22244801-22244823 CTGATAACCAGGGGAGAAGGTGG No data
903279947_903279953 8 Left 903279947 1:22244760-22244782 CCTCTGAGCCTTTGCTGCTGTGA No data
Right 903279953 1:22244791-22244813 GTATGGGTTACTGATAACCAGGG No data
903279947_903279955 15 Left 903279947 1:22244760-22244782 CCTCTGAGCCTTTGCTGCTGTGA No data
Right 903279955 1:22244798-22244820 TTACTGATAACCAGGGGAGAAGG No data
903279947_903279960 24 Left 903279947 1:22244760-22244782 CCTCTGAGCCTTTGCTGCTGTGA No data
Right 903279960 1:22244807-22244829 ACCAGGGGAGAAGGTGGGTGGGG No data
903279947_903279962 30 Left 903279947 1:22244760-22244782 CCTCTGAGCCTTTGCTGCTGTGA No data
Right 903279962 1:22244813-22244835 GGAGAAGGTGGGTGGGGTGCTGG No data
903279947_903279959 23 Left 903279947 1:22244760-22244782 CCTCTGAGCCTTTGCTGCTGTGA No data
Right 903279959 1:22244806-22244828 AACCAGGGGAGAAGGTGGGTGGG No data
903279947_903279949 -9 Left 903279947 1:22244760-22244782 CCTCTGAGCCTTTGCTGCTGTGA No data
Right 903279949 1:22244774-22244796 CTGCTGTGATCGCCTCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903279947 Original CRISPR TCACAGCAGCAAAGGCTCAG AGG (reversed) Intergenic
No off target data available for this crispr