ID: 903279948

View in Genome Browser
Species Human (GRCh38)
Location 1:22244768-22244790
Sequence AGAGGCGATCACAGCAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903279948_903279952 -1 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279952 1:22244790-22244812 TGTATGGGTTACTGATAACCAGG No data
903279948_903279959 15 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279959 1:22244806-22244828 AACCAGGGGAGAAGGTGGGTGGG No data
903279948_903279962 22 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279962 1:22244813-22244835 GGAGAAGGTGGGTGGGGTGCTGG No data
903279948_903279958 14 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279958 1:22244805-22244827 TAACCAGGGGAGAAGGTGGGTGG No data
903279948_903279965 25 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279965 1:22244816-22244838 GAAGGTGGGTGGGGTGCTGGGGG No data
903279948_903279953 0 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279953 1:22244791-22244813 GTATGGGTTACTGATAACCAGGG No data
903279948_903279954 1 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279954 1:22244792-22244814 TATGGGTTACTGATAACCAGGGG No data
903279948_903279956 10 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279956 1:22244801-22244823 CTGATAACCAGGGGAGAAGGTGG No data
903279948_903279967 29 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279967 1:22244820-22244842 GTGGGTGGGGTGCTGGGGGGAGG No data
903279948_903279966 26 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279966 1:22244817-22244839 AAGGTGGGTGGGGTGCTGGGGGG No data
903279948_903279955 7 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279955 1:22244798-22244820 TTACTGATAACCAGGGGAGAAGG No data
903279948_903279960 16 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279960 1:22244807-22244829 ACCAGGGGAGAAGGTGGGTGGGG No data
903279948_903279964 24 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279964 1:22244815-22244837 AGAAGGTGGGTGGGGTGCTGGGG No data
903279948_903279957 11 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279957 1:22244802-22244824 TGATAACCAGGGGAGAAGGTGGG No data
903279948_903279963 23 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279963 1:22244814-22244836 GAGAAGGTGGGTGGGGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903279948 Original CRISPR AGAGGCGATCACAGCAGCAA AGG (reversed) Intergenic
No off target data available for this crispr