ID: 903279954

View in Genome Browser
Species Human (GRCh38)
Location 1:22244792-22244814
Sequence TATGGGTTACTGATAACCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903279946_903279954 10 Left 903279946 1:22244759-22244781 CCCTCTGAGCCTTTGCTGCTGTG No data
Right 903279954 1:22244792-22244814 TATGGGTTACTGATAACCAGGGG No data
903279948_903279954 1 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279954 1:22244792-22244814 TATGGGTTACTGATAACCAGGGG No data
903279947_903279954 9 Left 903279947 1:22244760-22244782 CCTCTGAGCCTTTGCTGCTGTGA No data
Right 903279954 1:22244792-22244814 TATGGGTTACTGATAACCAGGGG No data
903279944_903279954 19 Left 903279944 1:22244750-22244772 CCCTGGCTGCCCTCTGAGCCTTT No data
Right 903279954 1:22244792-22244814 TATGGGTTACTGATAACCAGGGG No data
903279945_903279954 18 Left 903279945 1:22244751-22244773 CCTGGCTGCCCTCTGAGCCTTTG No data
Right 903279954 1:22244792-22244814 TATGGGTTACTGATAACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903279954 Original CRISPR TATGGGTTACTGATAACCAG GGG Intergenic
No off target data available for this crispr