ID: 903279956

View in Genome Browser
Species Human (GRCh38)
Location 1:22244801-22244823
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903279951_903279956 -8 Left 903279951 1:22244786-22244808 CCTCTGTATGGGTTACTGATAAC No data
Right 903279956 1:22244801-22244823 CTGATAACCAGGGGAGAAGGTGG No data
903279945_903279956 27 Left 903279945 1:22244751-22244773 CCTGGCTGCCCTCTGAGCCTTTG No data
Right 903279956 1:22244801-22244823 CTGATAACCAGGGGAGAAGGTGG No data
903279946_903279956 19 Left 903279946 1:22244759-22244781 CCCTCTGAGCCTTTGCTGCTGTG No data
Right 903279956 1:22244801-22244823 CTGATAACCAGGGGAGAAGGTGG No data
903279944_903279956 28 Left 903279944 1:22244750-22244772 CCCTGGCTGCCCTCTGAGCCTTT No data
Right 903279956 1:22244801-22244823 CTGATAACCAGGGGAGAAGGTGG No data
903279947_903279956 18 Left 903279947 1:22244760-22244782 CCTCTGAGCCTTTGCTGCTGTGA No data
Right 903279956 1:22244801-22244823 CTGATAACCAGGGGAGAAGGTGG No data
903279948_903279956 10 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279956 1:22244801-22244823 CTGATAACCAGGGGAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr