ID: 903279959

View in Genome Browser
Species Human (GRCh38)
Location 1:22244806-22244828
Sequence AACCAGGGGAGAAGGTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903279951_903279959 -3 Left 903279951 1:22244786-22244808 CCTCTGTATGGGTTACTGATAAC No data
Right 903279959 1:22244806-22244828 AACCAGGGGAGAAGGTGGGTGGG No data
903279947_903279959 23 Left 903279947 1:22244760-22244782 CCTCTGAGCCTTTGCTGCTGTGA No data
Right 903279959 1:22244806-22244828 AACCAGGGGAGAAGGTGGGTGGG No data
903279946_903279959 24 Left 903279946 1:22244759-22244781 CCCTCTGAGCCTTTGCTGCTGTG No data
Right 903279959 1:22244806-22244828 AACCAGGGGAGAAGGTGGGTGGG No data
903279948_903279959 15 Left 903279948 1:22244768-22244790 CCTTTGCTGCTGTGATCGCCTCT No data
Right 903279959 1:22244806-22244828 AACCAGGGGAGAAGGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903279959 Original CRISPR AACCAGGGGAGAAGGTGGGT GGG Intergenic
No off target data available for this crispr