ID: 903287616

View in Genome Browser
Species Human (GRCh38)
Location 1:22286584-22286606
Sequence TTGTCCCCAAGGAACCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903287616_903287622 9 Left 903287616 1:22286584-22286606 CCAGAGGGGTTCCTTGGGGACAA No data
Right 903287622 1:22286616-22286638 CAGCCTTGCTCTCCAGTGAGGGG No data
903287616_903287621 8 Left 903287616 1:22286584-22286606 CCAGAGGGGTTCCTTGGGGACAA No data
Right 903287621 1:22286615-22286637 ACAGCCTTGCTCTCCAGTGAGGG No data
903287616_903287626 21 Left 903287616 1:22286584-22286606 CCAGAGGGGTTCCTTGGGGACAA No data
Right 903287626 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
903287616_903287623 10 Left 903287616 1:22286584-22286606 CCAGAGGGGTTCCTTGGGGACAA No data
Right 903287623 1:22286617-22286639 AGCCTTGCTCTCCAGTGAGGGGG No data
903287616_903287620 7 Left 903287616 1:22286584-22286606 CCAGAGGGGTTCCTTGGGGACAA No data
Right 903287620 1:22286614-22286636 CACAGCCTTGCTCTCCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903287616 Original CRISPR TTGTCCCCAAGGAACCCCTC TGG (reversed) Intergenic