ID: 903287617

View in Genome Browser
Species Human (GRCh38)
Location 1:22286595-22286617
Sequence TGTGGGCTACATTGTCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903287617_903287622 -2 Left 903287617 1:22286595-22286617 CCTTGGGGACAATGTAGCCCACA No data
Right 903287622 1:22286616-22286638 CAGCCTTGCTCTCCAGTGAGGGG No data
903287617_903287627 20 Left 903287617 1:22286595-22286617 CCTTGGGGACAATGTAGCCCACA No data
Right 903287627 1:22286638-22286660 GGCCCTCAGTTGGTGTTGCCTGG No data
903287617_903287632 23 Left 903287617 1:22286595-22286617 CCTTGGGGACAATGTAGCCCACA No data
Right 903287632 1:22286641-22286663 CCTCAGTTGGTGTTGCCTGGGGG No data
903287617_903287621 -3 Left 903287617 1:22286595-22286617 CCTTGGGGACAATGTAGCCCACA No data
Right 903287621 1:22286615-22286637 ACAGCCTTGCTCTCCAGTGAGGG No data
903287617_903287620 -4 Left 903287617 1:22286595-22286617 CCTTGGGGACAATGTAGCCCACA No data
Right 903287620 1:22286614-22286636 CACAGCCTTGCTCTCCAGTGAGG No data
903287617_903287623 -1 Left 903287617 1:22286595-22286617 CCTTGGGGACAATGTAGCCCACA No data
Right 903287623 1:22286617-22286639 AGCCTTGCTCTCCAGTGAGGGGG No data
903287617_903287630 22 Left 903287617 1:22286595-22286617 CCTTGGGGACAATGTAGCCCACA No data
Right 903287630 1:22286640-22286662 CCCTCAGTTGGTGTTGCCTGGGG No data
903287617_903287633 28 Left 903287617 1:22286595-22286617 CCTTGGGGACAATGTAGCCCACA No data
Right 903287633 1:22286646-22286668 GTTGGTGTTGCCTGGGGGTCTGG No data
903287617_903287626 10 Left 903287617 1:22286595-22286617 CCTTGGGGACAATGTAGCCCACA No data
Right 903287626 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG 0: 1
1: 0
2: 1
3: 12
4: 188
903287617_903287628 21 Left 903287617 1:22286595-22286617 CCTTGGGGACAATGTAGCCCACA No data
Right 903287628 1:22286639-22286661 GCCCTCAGTTGGTGTTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903287617 Original CRISPR TGTGGGCTACATTGTCCCCA AGG (reversed) Intergenic