ID: 903287618

View in Genome Browser
Species Human (GRCh38)
Location 1:22286612-22286634
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903287618_903287636 19 Left 903287618 1:22286612-22286634 CCCACAGCCTTGCTCTCCAGTGA No data
Right 903287636 1:22286654-22286676 TGCCTGGGGGTCTGGCCGTGGGG No data
903287618_903287635 18 Left 903287618 1:22286612-22286634 CCCACAGCCTTGCTCTCCAGTGA No data
Right 903287635 1:22286653-22286675 TTGCCTGGGGGTCTGGCCGTGGG No data
903287618_903287639 27 Left 903287618 1:22286612-22286634 CCCACAGCCTTGCTCTCCAGTGA No data
Right 903287639 1:22286662-22286684 GGTCTGGCCGTGGGGTTTGGAGG No data
903287618_903287630 5 Left 903287618 1:22286612-22286634 CCCACAGCCTTGCTCTCCAGTGA No data
Right 903287630 1:22286640-22286662 CCCTCAGTTGGTGTTGCCTGGGG No data
903287618_903287632 6 Left 903287618 1:22286612-22286634 CCCACAGCCTTGCTCTCCAGTGA No data
Right 903287632 1:22286641-22286663 CCTCAGTTGGTGTTGCCTGGGGG No data
903287618_903287626 -7 Left 903287618 1:22286612-22286634 CCCACAGCCTTGCTCTCCAGTGA No data
Right 903287626 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
903287618_903287627 3 Left 903287618 1:22286612-22286634 CCCACAGCCTTGCTCTCCAGTGA No data
Right 903287627 1:22286638-22286660 GGCCCTCAGTTGGTGTTGCCTGG No data
903287618_903287633 11 Left 903287618 1:22286612-22286634 CCCACAGCCTTGCTCTCCAGTGA No data
Right 903287633 1:22286646-22286668 GTTGGTGTTGCCTGGGGGTCTGG No data
903287618_903287638 24 Left 903287618 1:22286612-22286634 CCCACAGCCTTGCTCTCCAGTGA No data
Right 903287638 1:22286659-22286681 GGGGGTCTGGCCGTGGGGTTTGG No data
903287618_903287634 17 Left 903287618 1:22286612-22286634 CCCACAGCCTTGCTCTCCAGTGA No data
Right 903287634 1:22286652-22286674 GTTGCCTGGGGGTCTGGCCGTGG No data
903287618_903287628 4 Left 903287618 1:22286612-22286634 CCCACAGCCTTGCTCTCCAGTGA No data
Right 903287628 1:22286639-22286661 GCCCTCAGTTGGTGTTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903287618 Original CRISPR TCACTGGAGAGCAAGGCTGT GGG (reversed) Intergenic