ID: 903287619

View in Genome Browser
Species Human (GRCh38)
Location 1:22286613-22286635
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903287619_903287638 23 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287638 1:22286659-22286681 GGGGGTCTGGCCGTGGGGTTTGG No data
903287619_903287639 26 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287639 1:22286662-22286684 GGTCTGGCCGTGGGGTTTGGAGG No data
903287619_903287630 4 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287630 1:22286640-22286662 CCCTCAGTTGGTGTTGCCTGGGG No data
903287619_903287626 -8 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287626 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
903287619_903287627 2 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287627 1:22286638-22286660 GGCCCTCAGTTGGTGTTGCCTGG No data
903287619_903287634 16 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287634 1:22286652-22286674 GTTGCCTGGGGGTCTGGCCGTGG No data
903287619_903287632 5 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287632 1:22286641-22286663 CCTCAGTTGGTGTTGCCTGGGGG No data
903287619_903287633 10 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287633 1:22286646-22286668 GTTGGTGTTGCCTGGGGGTCTGG No data
903287619_903287628 3 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287628 1:22286639-22286661 GCCCTCAGTTGGTGTTGCCTGGG No data
903287619_903287640 30 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287640 1:22286666-22286688 TGGCCGTGGGGTTTGGAGGCTGG No data
903287619_903287636 18 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287636 1:22286654-22286676 TGCCTGGGGGTCTGGCCGTGGGG No data
903287619_903287635 17 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287635 1:22286653-22286675 TTGCCTGGGGGTCTGGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903287619 Original CRISPR CTCACTGGAGAGCAAGGCTG TGG (reversed) Intergenic