ID: 903287624

View in Genome Browser
Species Human (GRCh38)
Location 1:22286619-22286641
Sequence GGCCCCCTCACTGGAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903287624_903287632 -1 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287632 1:22286641-22286663 CCTCAGTTGGTGTTGCCTGGGGG No data
903287624_903287638 17 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287638 1:22286659-22286681 GGGGGTCTGGCCGTGGGGTTTGG No data
903287624_903287643 28 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287643 1:22286670-22286692 CGTGGGGTTTGGAGGCTGGTGGG No data
903287624_903287640 24 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287640 1:22286666-22286688 TGGCCGTGGGGTTTGGAGGCTGG No data
903287624_903287636 12 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287636 1:22286654-22286676 TGCCTGGGGGTCTGGCCGTGGGG No data
903287624_903287628 -3 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287628 1:22286639-22286661 GCCCTCAGTTGGTGTTGCCTGGG No data
903287624_903287635 11 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287635 1:22286653-22286675 TTGCCTGGGGGTCTGGCCGTGGG No data
903287624_903287639 20 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287639 1:22286662-22286684 GGTCTGGCCGTGGGGTTTGGAGG No data
903287624_903287627 -4 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287627 1:22286638-22286660 GGCCCTCAGTTGGTGTTGCCTGG No data
903287624_903287642 27 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287642 1:22286669-22286691 CCGTGGGGTTTGGAGGCTGGTGG No data
903287624_903287633 4 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287633 1:22286646-22286668 GTTGGTGTTGCCTGGGGGTCTGG No data
903287624_903287634 10 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287634 1:22286652-22286674 GTTGCCTGGGGGTCTGGCCGTGG No data
903287624_903287630 -2 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287630 1:22286640-22286662 CCCTCAGTTGGTGTTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903287624 Original CRISPR GGCCCCCTCACTGGAGAGCA AGG (reversed) Intergenic