ID: 903287625

View in Genome Browser
Species Human (GRCh38)
Location 1:22286628-22286650
Sequence CCAACTGAGGGCCCCCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903287625_903287643 19 Left 903287625 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
Right 903287643 1:22286670-22286692 CGTGGGGTTTGGAGGCTGGTGGG No data
903287625_903287638 8 Left 903287625 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
Right 903287638 1:22286659-22286681 GGGGGTCTGGCCGTGGGGTTTGG No data
903287625_903287642 18 Left 903287625 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
Right 903287642 1:22286669-22286691 CCGTGGGGTTTGGAGGCTGGTGG No data
903287625_903287640 15 Left 903287625 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
Right 903287640 1:22286666-22286688 TGGCCGTGGGGTTTGGAGGCTGG No data
903287625_903287635 2 Left 903287625 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
Right 903287635 1:22286653-22286675 TTGCCTGGGGGTCTGGCCGTGGG No data
903287625_903287636 3 Left 903287625 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
Right 903287636 1:22286654-22286676 TGCCTGGGGGTCTGGCCGTGGGG No data
903287625_903287633 -5 Left 903287625 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
Right 903287633 1:22286646-22286668 GTTGGTGTTGCCTGGGGGTCTGG No data
903287625_903287632 -10 Left 903287625 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
Right 903287632 1:22286641-22286663 CCTCAGTTGGTGTTGCCTGGGGG No data
903287625_903287634 1 Left 903287625 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
Right 903287634 1:22286652-22286674 GTTGCCTGGGGGTCTGGCCGTGG No data
903287625_903287639 11 Left 903287625 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
Right 903287639 1:22286662-22286684 GGTCTGGCCGTGGGGTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903287625 Original CRISPR CCAACTGAGGGCCCCCTCAC TGG (reversed) Intergenic
No off target data available for this crispr