ID: 903287626

View in Genome Browser
Species Human (GRCh38)
Location 1:22286628-22286650
Sequence CCAGTGAGGGGGCCCTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903287619_903287626 -8 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287626 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
903287614_903287626 23 Left 903287614 1:22286582-22286604 CCCCAGAGGGGTTCCTTGGGGAC No data
Right 903287626 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
903287618_903287626 -7 Left 903287618 1:22286612-22286634 CCCACAGCCTTGCTCTCCAGTGA No data
Right 903287626 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
903287617_903287626 10 Left 903287617 1:22286595-22286617 CCTTGGGGACAATGTAGCCCACA No data
Right 903287626 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
903287615_903287626 22 Left 903287615 1:22286583-22286605 CCCAGAGGGGTTCCTTGGGGACA No data
Right 903287626 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
903287613_903287626 24 Left 903287613 1:22286581-22286603 CCCCCAGAGGGGTTCCTTGGGGA No data
Right 903287626 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
903287616_903287626 21 Left 903287616 1:22286584-22286606 CCAGAGGGGTTCCTTGGGGACAA No data
Right 903287626 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903287626 Original CRISPR CCAGTGAGGGGGCCCTCAGT TGG Intergenic