ID: 903287627

View in Genome Browser
Species Human (GRCh38)
Location 1:22286638-22286660
Sequence GGCCCTCAGTTGGTGTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903287619_903287627 2 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287627 1:22286638-22286660 GGCCCTCAGTTGGTGTTGCCTGG No data
903287617_903287627 20 Left 903287617 1:22286595-22286617 CCTTGGGGACAATGTAGCCCACA No data
Right 903287627 1:22286638-22286660 GGCCCTCAGTTGGTGTTGCCTGG No data
903287624_903287627 -4 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287627 1:22286638-22286660 GGCCCTCAGTTGGTGTTGCCTGG No data
903287618_903287627 3 Left 903287618 1:22286612-22286634 CCCACAGCCTTGCTCTCCAGTGA No data
Right 903287627 1:22286638-22286660 GGCCCTCAGTTGGTGTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903287627 Original CRISPR GGCCCTCAGTTGGTGTTGCC TGG Intergenic