ID: 903287633

View in Genome Browser
Species Human (GRCh38)
Location 1:22286646-22286668
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903287625_903287633 -5 Left 903287625 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
Right 903287633 1:22286646-22286668 GTTGGTGTTGCCTGGGGGTCTGG No data
903287617_903287633 28 Left 903287617 1:22286595-22286617 CCTTGGGGACAATGTAGCCCACA No data
Right 903287633 1:22286646-22286668 GTTGGTGTTGCCTGGGGGTCTGG No data
903287618_903287633 11 Left 903287618 1:22286612-22286634 CCCACAGCCTTGCTCTCCAGTGA No data
Right 903287633 1:22286646-22286668 GTTGGTGTTGCCTGGGGGTCTGG No data
903287624_903287633 4 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287633 1:22286646-22286668 GTTGGTGTTGCCTGGGGGTCTGG No data
903287619_903287633 10 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287633 1:22286646-22286668 GTTGGTGTTGCCTGGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr