ID: 903287635

View in Genome Browser
Species Human (GRCh38)
Location 1:22286653-22286675
Sequence TTGCCTGGGGGTCTGGCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903287624_903287635 11 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287635 1:22286653-22286675 TTGCCTGGGGGTCTGGCCGTGGG No data
903287618_903287635 18 Left 903287618 1:22286612-22286634 CCCACAGCCTTGCTCTCCAGTGA No data
Right 903287635 1:22286653-22286675 TTGCCTGGGGGTCTGGCCGTGGG No data
903287619_903287635 17 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287635 1:22286653-22286675 TTGCCTGGGGGTCTGGCCGTGGG No data
903287629_903287635 -10 Left 903287629 1:22286640-22286662 CCCTCAGTTGGTGTTGCCTGGGG No data
Right 903287635 1:22286653-22286675 TTGCCTGGGGGTCTGGCCGTGGG No data
903287625_903287635 2 Left 903287625 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
Right 903287635 1:22286653-22286675 TTGCCTGGGGGTCTGGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903287635 Original CRISPR TTGCCTGGGGGTCTGGCCGT GGG Intergenic
No off target data available for this crispr