ID: 903287636

View in Genome Browser
Species Human (GRCh38)
Location 1:22286654-22286676
Sequence TGCCTGGGGGTCTGGCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903287631_903287636 -10 Left 903287631 1:22286641-22286663 CCTCAGTTGGTGTTGCCTGGGGG No data
Right 903287636 1:22286654-22286676 TGCCTGGGGGTCTGGCCGTGGGG No data
903287624_903287636 12 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287636 1:22286654-22286676 TGCCTGGGGGTCTGGCCGTGGGG No data
903287625_903287636 3 Left 903287625 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
Right 903287636 1:22286654-22286676 TGCCTGGGGGTCTGGCCGTGGGG No data
903287619_903287636 18 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287636 1:22286654-22286676 TGCCTGGGGGTCTGGCCGTGGGG No data
903287629_903287636 -9 Left 903287629 1:22286640-22286662 CCCTCAGTTGGTGTTGCCTGGGG No data
Right 903287636 1:22286654-22286676 TGCCTGGGGGTCTGGCCGTGGGG No data
903287618_903287636 19 Left 903287618 1:22286612-22286634 CCCACAGCCTTGCTCTCCAGTGA No data
Right 903287636 1:22286654-22286676 TGCCTGGGGGTCTGGCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903287636 Original CRISPR TGCCTGGGGGTCTGGCCGTG GGG Intergenic
No off target data available for this crispr