ID: 903287640

View in Genome Browser
Species Human (GRCh38)
Location 1:22286666-22286688
Sequence TGGCCGTGGGGTTTGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903287624_903287640 24 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287640 1:22286666-22286688 TGGCCGTGGGGTTTGGAGGCTGG No data
903287625_903287640 15 Left 903287625 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
Right 903287640 1:22286666-22286688 TGGCCGTGGGGTTTGGAGGCTGG No data
903287631_903287640 2 Left 903287631 1:22286641-22286663 CCTCAGTTGGTGTTGCCTGGGGG No data
Right 903287640 1:22286666-22286688 TGGCCGTGGGGTTTGGAGGCTGG No data
903287629_903287640 3 Left 903287629 1:22286640-22286662 CCCTCAGTTGGTGTTGCCTGGGG No data
Right 903287640 1:22286666-22286688 TGGCCGTGGGGTTTGGAGGCTGG No data
903287619_903287640 30 Left 903287619 1:22286613-22286635 CCACAGCCTTGCTCTCCAGTGAG No data
Right 903287640 1:22286666-22286688 TGGCCGTGGGGTTTGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903287640 Original CRISPR TGGCCGTGGGGTTTGGAGGC TGG Intergenic