ID: 903287642

View in Genome Browser
Species Human (GRCh38)
Location 1:22286669-22286691
Sequence CCGTGGGGTTTGGAGGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903287624_903287642 27 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287642 1:22286669-22286691 CCGTGGGGTTTGGAGGCTGGTGG No data
903287637_903287642 -10 Left 903287637 1:22286656-22286678 CCTGGGGGTCTGGCCGTGGGGTT No data
Right 903287642 1:22286669-22286691 CCGTGGGGTTTGGAGGCTGGTGG No data
903287631_903287642 5 Left 903287631 1:22286641-22286663 CCTCAGTTGGTGTTGCCTGGGGG No data
Right 903287642 1:22286669-22286691 CCGTGGGGTTTGGAGGCTGGTGG No data
903287625_903287642 18 Left 903287625 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
Right 903287642 1:22286669-22286691 CCGTGGGGTTTGGAGGCTGGTGG No data
903287629_903287642 6 Left 903287629 1:22286640-22286662 CCCTCAGTTGGTGTTGCCTGGGG No data
Right 903287642 1:22286669-22286691 CCGTGGGGTTTGGAGGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903287642 Original CRISPR CCGTGGGGTTTGGAGGCTGG TGG Intergenic
No off target data available for this crispr