ID: 903287643

View in Genome Browser
Species Human (GRCh38)
Location 1:22286670-22286692
Sequence CGTGGGGTTTGGAGGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903287625_903287643 19 Left 903287625 1:22286628-22286650 CCAGTGAGGGGGCCCTCAGTTGG No data
Right 903287643 1:22286670-22286692 CGTGGGGTTTGGAGGCTGGTGGG No data
903287624_903287643 28 Left 903287624 1:22286619-22286641 CCTTGCTCTCCAGTGAGGGGGCC No data
Right 903287643 1:22286670-22286692 CGTGGGGTTTGGAGGCTGGTGGG No data
903287629_903287643 7 Left 903287629 1:22286640-22286662 CCCTCAGTTGGTGTTGCCTGGGG No data
Right 903287643 1:22286670-22286692 CGTGGGGTTTGGAGGCTGGTGGG No data
903287631_903287643 6 Left 903287631 1:22286641-22286663 CCTCAGTTGGTGTTGCCTGGGGG No data
Right 903287643 1:22286670-22286692 CGTGGGGTTTGGAGGCTGGTGGG No data
903287637_903287643 -9 Left 903287637 1:22286656-22286678 CCTGGGGGTCTGGCCGTGGGGTT No data
Right 903287643 1:22286670-22286692 CGTGGGGTTTGGAGGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903287643 Original CRISPR CGTGGGGTTTGGAGGCTGGT GGG Intergenic