ID: 903288261

View in Genome Browser
Species Human (GRCh38)
Location 1:22290645-22290667
Sequence GGTCATGCCCAAGAGGGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903288261_903288264 -7 Left 903288261 1:22290645-22290667 CCGGTGCCCTCTTGGGCATGACC No data
Right 903288264 1:22290661-22290683 CATGACCCCCTAGACCCACCTGG No data
903288261_903288274 30 Left 903288261 1:22290645-22290667 CCGGTGCCCTCTTGGGCATGACC No data
Right 903288274 1:22290698-22290720 TCCAGCACAACGCTCCTCTGTGG No data
903288261_903288267 -1 Left 903288261 1:22290645-22290667 CCGGTGCCCTCTTGGGCATGACC No data
Right 903288267 1:22290667-22290689 CCCCTAGACCCACCTGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903288261 Original CRISPR GGTCATGCCCAAGAGGGCAC CGG (reversed) Intergenic
No off target data available for this crispr