ID: 903288313

View in Genome Browser
Species Human (GRCh38)
Location 1:22290949-22290971
Sequence TTTTGATGTGTTGAGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903288313_903288318 7 Left 903288313 1:22290949-22290971 CCCAGCTTCTCAACACATCAAAA No data
Right 903288318 1:22290979-22291001 CTGGCTGATGTCGCTGGTGTGGG No data
903288313_903288320 11 Left 903288313 1:22290949-22290971 CCCAGCTTCTCAACACATCAAAA No data
Right 903288320 1:22290983-22291005 CTGATGTCGCTGGTGTGGGGTGG No data
903288313_903288316 1 Left 903288313 1:22290949-22290971 CCCAGCTTCTCAACACATCAAAA No data
Right 903288316 1:22290973-22290995 AGTTTTCTGGCTGATGTCGCTGG No data
903288313_903288317 6 Left 903288313 1:22290949-22290971 CCCAGCTTCTCAACACATCAAAA No data
Right 903288317 1:22290978-22291000 TCTGGCTGATGTCGCTGGTGTGG No data
903288313_903288319 8 Left 903288313 1:22290949-22290971 CCCAGCTTCTCAACACATCAAAA No data
Right 903288319 1:22290980-22291002 TGGCTGATGTCGCTGGTGTGGGG No data
903288313_903288321 12 Left 903288313 1:22290949-22290971 CCCAGCTTCTCAACACATCAAAA No data
Right 903288321 1:22290984-22291006 TGATGTCGCTGGTGTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903288313 Original CRISPR TTTTGATGTGTTGAGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr