ID: 903288314

View in Genome Browser
Species Human (GRCh38)
Location 1:22290950-22290972
Sequence TTTTTGATGTGTTGAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903288314_903288316 0 Left 903288314 1:22290950-22290972 CCAGCTTCTCAACACATCAAAAA No data
Right 903288316 1:22290973-22290995 AGTTTTCTGGCTGATGTCGCTGG No data
903288314_903288318 6 Left 903288314 1:22290950-22290972 CCAGCTTCTCAACACATCAAAAA No data
Right 903288318 1:22290979-22291001 CTGGCTGATGTCGCTGGTGTGGG No data
903288314_903288317 5 Left 903288314 1:22290950-22290972 CCAGCTTCTCAACACATCAAAAA No data
Right 903288317 1:22290978-22291000 TCTGGCTGATGTCGCTGGTGTGG No data
903288314_903288321 11 Left 903288314 1:22290950-22290972 CCAGCTTCTCAACACATCAAAAA No data
Right 903288321 1:22290984-22291006 TGATGTCGCTGGTGTGGGGTGGG No data
903288314_903288320 10 Left 903288314 1:22290950-22290972 CCAGCTTCTCAACACATCAAAAA No data
Right 903288320 1:22290983-22291005 CTGATGTCGCTGGTGTGGGGTGG No data
903288314_903288319 7 Left 903288314 1:22290950-22290972 CCAGCTTCTCAACACATCAAAAA No data
Right 903288319 1:22290980-22291002 TGGCTGATGTCGCTGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903288314 Original CRISPR TTTTTGATGTGTTGAGAAGC TGG (reversed) Intergenic
No off target data available for this crispr