ID: 903288321

View in Genome Browser
Species Human (GRCh38)
Location 1:22290984-22291006
Sequence TGATGTCGCTGGTGTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903288314_903288321 11 Left 903288314 1:22290950-22290972 CCAGCTTCTCAACACATCAAAAA No data
Right 903288321 1:22290984-22291006 TGATGTCGCTGGTGTGGGGTGGG No data
903288313_903288321 12 Left 903288313 1:22290949-22290971 CCCAGCTTCTCAACACATCAAAA No data
Right 903288321 1:22290984-22291006 TGATGTCGCTGGTGTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903288321 Original CRISPR TGATGTCGCTGGTGTGGGGT GGG Intergenic
No off target data available for this crispr