ID: 903290735

View in Genome Browser
Species Human (GRCh38)
Location 1:22312633-22312655
Sequence TTTTCTATCCAGGAGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903290724_903290735 29 Left 903290724 1:22312581-22312603 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 903290735 1:22312633-22312655 TTTTCTATCCAGGAGCTGCCTGG No data
903290729_903290735 -7 Left 903290729 1:22312617-22312639 CCCGGCCAGACCTTCCTTTTCTA No data
Right 903290735 1:22312633-22312655 TTTTCTATCCAGGAGCTGCCTGG No data
903290728_903290735 1 Left 903290728 1:22312609-22312631 CCACGGCGCCCGGCCAGACCTTC No data
Right 903290735 1:22312633-22312655 TTTTCTATCCAGGAGCTGCCTGG No data
903290725_903290735 28 Left 903290725 1:22312582-22312604 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 903290735 1:22312633-22312655 TTTTCTATCCAGGAGCTGCCTGG No data
903290730_903290735 -8 Left 903290730 1:22312618-22312640 CCGGCCAGACCTTCCTTTTCTAT No data
Right 903290735 1:22312633-22312655 TTTTCTATCCAGGAGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903290735 Original CRISPR TTTTCTATCCAGGAGCTGCC TGG Intergenic
No off target data available for this crispr