ID: 903291406

View in Genome Browser
Species Human (GRCh38)
Location 1:22316488-22316510
Sequence TACAGAAGGCTGGTGGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903291406_903291422 20 Left 903291406 1:22316488-22316510 CCCGCCACCACCAGCCTTCTGTA No data
Right 903291422 1:22316531-22316553 TCACAGCAGGAATGGGGCTGGGG No data
903291406_903291416 12 Left 903291406 1:22316488-22316510 CCCGCCACCACCAGCCTTCTGTA No data
Right 903291416 1:22316523-22316545 TTAGGTCCTCACAGCAGGAATGG No data
903291406_903291412 -6 Left 903291406 1:22316488-22316510 CCCGCCACCACCAGCCTTCTGTA No data
Right 903291412 1:22316505-22316527 TCTGTATGCATTTACCCTTTAGG No data
903291406_903291421 19 Left 903291406 1:22316488-22316510 CCCGCCACCACCAGCCTTCTGTA No data
Right 903291421 1:22316530-22316552 CTCACAGCAGGAATGGGGCTGGG No data
903291406_903291420 18 Left 903291406 1:22316488-22316510 CCCGCCACCACCAGCCTTCTGTA No data
Right 903291420 1:22316529-22316551 CCTCACAGCAGGAATGGGGCTGG No data
903291406_903291423 24 Left 903291406 1:22316488-22316510 CCCGCCACCACCAGCCTTCTGTA No data
Right 903291423 1:22316535-22316557 AGCAGGAATGGGGCTGGGGTTGG No data
903291406_903291413 7 Left 903291406 1:22316488-22316510 CCCGCCACCACCAGCCTTCTGTA No data
Right 903291413 1:22316518-22316540 ACCCTTTAGGTCCTCACAGCAGG No data
903291406_903291417 13 Left 903291406 1:22316488-22316510 CCCGCCACCACCAGCCTTCTGTA No data
Right 903291417 1:22316524-22316546 TAGGTCCTCACAGCAGGAATGGG No data
903291406_903291418 14 Left 903291406 1:22316488-22316510 CCCGCCACCACCAGCCTTCTGTA No data
Right 903291418 1:22316525-22316547 AGGTCCTCACAGCAGGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903291406 Original CRISPR TACAGAAGGCTGGTGGTGGC GGG (reversed) Intergenic
No off target data available for this crispr