ID: 903291785

View in Genome Browser
Species Human (GRCh38)
Location 1:22318653-22318675
Sequence TGGCCCCACAAAGCCCGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903291785_903291790 -4 Left 903291785 1:22318653-22318675 CCCTCTCGGGCTTTGTGGGGCCA No data
Right 903291790 1:22318672-22318694 GCCAAGGCCTGGCAGGCTGCTGG No data
903291785_903291794 15 Left 903291785 1:22318653-22318675 CCCTCTCGGGCTTTGTGGGGCCA No data
Right 903291794 1:22318691-22318713 CTGGCTCCAGACGGCCCCTGCGG No data
903291785_903291796 24 Left 903291785 1:22318653-22318675 CCCTCTCGGGCTTTGTGGGGCCA No data
Right 903291796 1:22318700-22318722 GACGGCCCCTGCGGTTGCCGTGG No data
903291785_903291793 6 Left 903291785 1:22318653-22318675 CCCTCTCGGGCTTTGTGGGGCCA No data
Right 903291793 1:22318682-22318704 GGCAGGCTGCTGGCTCCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903291785 Original CRISPR TGGCCCCACAAAGCCCGAGA GGG (reversed) Intergenic