ID: 903292919

View in Genome Browser
Species Human (GRCh38)
Location 1:22326074-22326096
Sequence GAAGATTCACAGAGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903292919_903292925 -3 Left 903292919 1:22326074-22326096 CCTCCCTCCCTCTGTGAATCTTC No data
Right 903292925 1:22326094-22326116 TTCACCAGAGAGGACCCAGCAGG No data
903292919_903292926 -2 Left 903292919 1:22326074-22326096 CCTCCCTCCCTCTGTGAATCTTC No data
Right 903292926 1:22326095-22326117 TCACCAGAGAGGACCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903292919 Original CRISPR GAAGATTCACAGAGGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr