ID: 903294050

View in Genome Browser
Species Human (GRCh38)
Location 1:22332473-22332495
Sequence CAGTAGGCTTTGAGGAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903294050_903294064 24 Left 903294050 1:22332473-22332495 CCTACTTTCCTCAAAGCCTACTG No data
Right 903294064 1:22332520-22332542 GGCCTCTGCCAGGCCAAGGCGGG No data
903294050_903294067 28 Left 903294050 1:22332473-22332495 CCTACTTTCCTCAAAGCCTACTG No data
Right 903294067 1:22332524-22332546 TCTGCCAGGCCAAGGCGGGTGGG No data
903294050_903294056 1 Left 903294050 1:22332473-22332495 CCTACTTTCCTCAAAGCCTACTG No data
Right 903294056 1:22332497-22332519 GTCCCAGGGGAAAGTAGCAACGG No data
903294050_903294059 3 Left 903294050 1:22332473-22332495 CCTACTTTCCTCAAAGCCTACTG No data
Right 903294059 1:22332499-22332521 CCCAGGGGAAAGTAGCAACGGGG No data
903294050_903294062 20 Left 903294050 1:22332473-22332495 CCTACTTTCCTCAAAGCCTACTG No data
Right 903294062 1:22332516-22332538 ACGGGGCCTCTGCCAGGCCAAGG No data
903294050_903294063 23 Left 903294050 1:22332473-22332495 CCTACTTTCCTCAAAGCCTACTG No data
Right 903294063 1:22332519-22332541 GGGCCTCTGCCAGGCCAAGGCGG No data
903294050_903294057 2 Left 903294050 1:22332473-22332495 CCTACTTTCCTCAAAGCCTACTG No data
Right 903294057 1:22332498-22332520 TCCCAGGGGAAAGTAGCAACGGG No data
903294050_903294066 27 Left 903294050 1:22332473-22332495 CCTACTTTCCTCAAAGCCTACTG No data
Right 903294066 1:22332523-22332545 CTCTGCCAGGCCAAGGCGGGTGG No data
903294050_903294061 14 Left 903294050 1:22332473-22332495 CCTACTTTCCTCAAAGCCTACTG No data
Right 903294061 1:22332510-22332532 GTAGCAACGGGGCCTCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903294050 Original CRISPR CAGTAGGCTTTGAGGAAAGT AGG (reversed) Intergenic
No off target data available for this crispr