ID: 903296337

View in Genome Browser
Species Human (GRCh38)
Location 1:22345424-22345446
Sequence ACGGATGCACCAGGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903296337_903296353 30 Left 903296337 1:22345424-22345446 CCATCCACCCCTGGTGCATCCGT No data
Right 903296353 1:22345477-22345499 CAGCTTCGCTGCATCGCTATGGG No data
903296337_903296352 29 Left 903296337 1:22345424-22345446 CCATCCACCCCTGGTGCATCCGT No data
Right 903296352 1:22345476-22345498 CCAGCTTCGCTGCATCGCTATGG No data
903296337_903296342 -8 Left 903296337 1:22345424-22345446 CCATCCACCCCTGGTGCATCCGT No data
Right 903296342 1:22345439-22345461 GCATCCGTTCCGTCCACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903296337 Original CRISPR ACGGATGCACCAGGGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr