ID: 903296451

View in Genome Browser
Species Human (GRCh38)
Location 1:22346300-22346322
Sequence TCACGAGTCCCTCAGCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903296446_903296451 20 Left 903296446 1:22346257-22346279 CCTTTGGAGCTTCTTGGATTTCA No data
Right 903296451 1:22346300-22346322 TCACGAGTCCCTCAGCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903296451 Original CRISPR TCACGAGTCCCTCAGCCAGG TGG Intergenic
No off target data available for this crispr