ID: 903298011

View in Genome Browser
Species Human (GRCh38)
Location 1:22358038-22358060
Sequence CCATGCGGGATGGGAACCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903298011_903298020 -2 Left 903298011 1:22358038-22358060 CCCCGGGTTCCCATCCCGCATGG No data
Right 903298020 1:22358059-22358081 GGTTCCAGTGGATCAATCAATGG No data
903298011_903298023 3 Left 903298011 1:22358038-22358060 CCCCGGGTTCCCATCCCGCATGG No data
Right 903298023 1:22358064-22358086 CAGTGGATCAATCAATGGCAGGG No data
903298011_903298022 2 Left 903298011 1:22358038-22358060 CCCCGGGTTCCCATCCCGCATGG No data
Right 903298022 1:22358063-22358085 CCAGTGGATCAATCAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903298011 Original CRISPR CCATGCGGGATGGGAACCCG GGG (reversed) Intergenic
No off target data available for this crispr