ID: 903298020

View in Genome Browser
Species Human (GRCh38)
Location 1:22358059-22358081
Sequence GGTTCCAGTGGATCAATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903298013_903298020 -3 Left 903298013 1:22358039-22358061 CCCGGGTTCCCATCCCGCATGGT No data
Right 903298020 1:22358059-22358081 GGTTCCAGTGGATCAATCAATGG No data
903298011_903298020 -2 Left 903298011 1:22358038-22358060 CCCCGGGTTCCCATCCCGCATGG No data
Right 903298020 1:22358059-22358081 GGTTCCAGTGGATCAATCAATGG No data
903298014_903298020 -4 Left 903298014 1:22358040-22358062 CCGGGTTCCCATCCCGCATGGTT No data
Right 903298020 1:22358059-22358081 GGTTCCAGTGGATCAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903298020 Original CRISPR GGTTCCAGTGGATCAATCAA TGG Intergenic
No off target data available for this crispr