ID: 903299370

View in Genome Browser
Species Human (GRCh38)
Location 1:22367381-22367403
Sequence CTGCTGGGGTTGTGGAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903299361_903299370 26 Left 903299361 1:22367332-22367354 CCACAACTCCCCTTAATGAATTC No data
Right 903299370 1:22367381-22367403 CTGCTGGGGTTGTGGAGAAAAGG No data
903299362_903299370 18 Left 903299362 1:22367340-22367362 CCCCTTAATGAATTCAATACTGT No data
Right 903299370 1:22367381-22367403 CTGCTGGGGTTGTGGAGAAAAGG No data
903299363_903299370 17 Left 903299363 1:22367341-22367363 CCCTTAATGAATTCAATACTGTA No data
Right 903299370 1:22367381-22367403 CTGCTGGGGTTGTGGAGAAAAGG No data
903299364_903299370 16 Left 903299364 1:22367342-22367364 CCTTAATGAATTCAATACTGTAG No data
Right 903299370 1:22367381-22367403 CTGCTGGGGTTGTGGAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903299370 Original CRISPR CTGCTGGGGTTGTGGAGAAA AGG Intergenic
No off target data available for this crispr