ID: 903302051

View in Genome Browser
Species Human (GRCh38)
Location 1:22386155-22386177
Sequence GGCCACAGGGAGGCGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903302051_903302056 -3 Left 903302051 1:22386155-22386177 CCTGCCATCGCCTCCCTGTGGCC No data
Right 903302056 1:22386175-22386197 GCCTCCTTGCCCTCATCCTCTGG No data
903302051_903302058 -2 Left 903302051 1:22386155-22386177 CCTGCCATCGCCTCCCTGTGGCC No data
Right 903302058 1:22386176-22386198 CCTCCTTGCCCTCATCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903302051 Original CRISPR GGCCACAGGGAGGCGATGGC AGG (reversed) Intergenic
No off target data available for this crispr