ID: 903302355

View in Genome Browser
Species Human (GRCh38)
Location 1:22388556-22388578
Sequence CAGTCTCCACGCTGGTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903302355_903302358 9 Left 903302355 1:22388556-22388578 CCATTTTACCAGCGTGGAGACTG No data
Right 903302358 1:22388588-22388610 AAAGTACAGAAATTTGCCTAAGG No data
903302355_903302359 17 Left 903302355 1:22388556-22388578 CCATTTTACCAGCGTGGAGACTG No data
Right 903302359 1:22388596-22388618 GAAATTTGCCTAAGGTCTCCTGG No data
903302355_903302360 21 Left 903302355 1:22388556-22388578 CCATTTTACCAGCGTGGAGACTG No data
Right 903302360 1:22388600-22388622 TTTGCCTAAGGTCTCCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903302355 Original CRISPR CAGTCTCCACGCTGGTAAAA TGG (reversed) Intergenic
No off target data available for this crispr