ID: 903302358

View in Genome Browser
Species Human (GRCh38)
Location 1:22388588-22388610
Sequence AAAGTACAGAAATTTGCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903302352_903302358 21 Left 903302352 1:22388544-22388566 CCATTATTATTCCCATTTTACCA No data
Right 903302358 1:22388588-22388610 AAAGTACAGAAATTTGCCTAAGG No data
903302354_903302358 10 Left 903302354 1:22388555-22388577 CCCATTTTACCAGCGTGGAGACT No data
Right 903302358 1:22388588-22388610 AAAGTACAGAAATTTGCCTAAGG No data
903302355_903302358 9 Left 903302355 1:22388556-22388578 CCATTTTACCAGCGTGGAGACTG No data
Right 903302358 1:22388588-22388610 AAAGTACAGAAATTTGCCTAAGG No data
903302357_903302358 1 Left 903302357 1:22388564-22388586 CCAGCGTGGAGACTGAGGCAGAG No data
Right 903302358 1:22388588-22388610 AAAGTACAGAAATTTGCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903302358 Original CRISPR AAAGTACAGAAATTTGCCTA AGG Intergenic
No off target data available for this crispr