ID: 903302490

View in Genome Browser
Species Human (GRCh38)
Location 1:22389434-22389456
Sequence GGGGCTGGAGCCGCTTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903302478_903302490 29 Left 903302478 1:22389382-22389404 CCGTGTCATGGAAGGAGGAGGCT No data
Right 903302490 1:22389434-22389456 GGGGCTGGAGCCGCTTCTCTGGG No data
903302481_903302490 -2 Left 903302481 1:22389413-22389435 CCCCGTTTTTGTGCCTGGGTTGG No data
Right 903302490 1:22389434-22389456 GGGGCTGGAGCCGCTTCTCTGGG No data
903302485_903302490 -4 Left 903302485 1:22389415-22389437 CCGTTTTTGTGCCTGGGTTGGGG No data
Right 903302490 1:22389434-22389456 GGGGCTGGAGCCGCTTCTCTGGG No data
903302483_903302490 -3 Left 903302483 1:22389414-22389436 CCCGTTTTTGTGCCTGGGTTGGG No data
Right 903302490 1:22389434-22389456 GGGGCTGGAGCCGCTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903302490 Original CRISPR GGGGCTGGAGCCGCTTCTCT GGG Intergenic
No off target data available for this crispr