ID: 903307194

View in Genome Browser
Species Human (GRCh38)
Location 1:22421223-22421245
Sequence GTCCCACGAAATCAAACTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903307189_903307194 1 Left 903307189 1:22421199-22421221 CCAGAGTCCAGGCCTCCCAACTG No data
Right 903307194 1:22421223-22421245 GTCCCACGAAATCAAACTGTTGG No data
903307188_903307194 2 Left 903307188 1:22421198-22421220 CCCAGAGTCCAGGCCTCCCAACT No data
Right 903307194 1:22421223-22421245 GTCCCACGAAATCAAACTGTTGG No data
903307185_903307194 25 Left 903307185 1:22421175-22421197 CCCAGCTGTGAATGCAGATTTTA No data
Right 903307194 1:22421223-22421245 GTCCCACGAAATCAAACTGTTGG No data
903307186_903307194 24 Left 903307186 1:22421176-22421198 CCAGCTGTGAATGCAGATTTTAC No data
Right 903307194 1:22421223-22421245 GTCCCACGAAATCAAACTGTTGG No data
903307190_903307194 -6 Left 903307190 1:22421206-22421228 CCAGGCCTCCCAACTGAGTCCCA No data
Right 903307194 1:22421223-22421245 GTCCCACGAAATCAAACTGTTGG No data
903307184_903307194 30 Left 903307184 1:22421170-22421192 CCACGCCCAGCTGTGAATGCAGA No data
Right 903307194 1:22421223-22421245 GTCCCACGAAATCAAACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903307194 Original CRISPR GTCCCACGAAATCAAACTGT TGG Intergenic
No off target data available for this crispr