ID: 903312832

View in Genome Browser
Species Human (GRCh38)
Location 1:22473292-22473314
Sequence AAACTGTTCTAGTGGATAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 431}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903312829_903312832 11 Left 903312829 1:22473258-22473280 CCGCAGGTGATTCTTATGCACAT 0: 3
1: 41
2: 186
3: 584
4: 1561
Right 903312832 1:22473292-22473314 AAACTGTTCTAGTGGATAAAGGG 0: 1
1: 0
2: 0
3: 17
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903312832 Original CRISPR AAACTGTTCTAGTGGATAAA GGG Intronic
903182207 1:21610429-21610451 AAACTATTTTAGTTGAAAAATGG + Intronic
903312832 1:22473292-22473314 AAACTGTTCTAGTGGATAAAGGG + Intronic
903392522 1:22974587-22974609 AAAATGTTCTAGTTGACAATTGG - Intergenic
903966569 1:27094313-27094335 AAACTCTTCCAGTGGGTAATTGG - Intergenic
904904071 1:33881349-33881371 AAACTGTTCTGTAGGAGAAAGGG + Intronic
907046120 1:51301321-51301343 AAACAGTTCTACTGGACAGAGGG + Intronic
910351431 1:86303216-86303238 AAACTGTCCTTGTGGAAAATTGG - Intergenic
910422064 1:87076689-87076711 CAACTCTTCTAGTTGAAAAATGG + Intronic
915963515 1:160286153-160286175 AAACAGTTCTAATAGATAATAGG - Intronic
916696228 1:167239505-167239527 AAACTGCTTTAGTGGCTTAATGG + Intronic
921098048 1:211903751-211903773 GAAGAGTTCTAGTGGATACAGGG + Intergenic
922634546 1:227153855-227153877 AAACTGTTCTAGAGCCAAAATGG + Intronic
1065905813 10:30250182-30250204 TGACTGTAATAGTGGATAAATGG - Intergenic
1066825520 10:39569213-39569235 AAACTCTGCAAGTGGATAATTGG + Intergenic
1067192981 10:44088201-44088223 AAAATGTTCCAGTGCATAACAGG + Intergenic
1068698386 10:59993795-59993817 AAAGTATTCTAGTGAATAAATGG - Intergenic
1069445898 10:68472799-68472821 AAAGTGTTCTTCTGGTTAAAGGG + Intergenic
1070275885 10:75006304-75006326 AAACTGATTTAGAGGATAATAGG + Intronic
1070387009 10:75934821-75934843 AAACTGTTCTAAAAGAAAAAGGG - Intronic
1073527257 10:104195647-104195669 ACACAGTTCTAGTTGAGAAATGG - Intronic
1076485388 10:130812355-130812377 AAAATGTTCCTCTGGATAAATGG - Intergenic
1080490080 11:32752978-32753000 AAATTTTTCTTGTAGATAAAGGG + Intronic
1086823300 11:91463037-91463059 ACACTACTCTAGTTGATAAATGG - Intergenic
1087095139 11:94311100-94311122 AAAGTTTTAGAGTGGATAAAAGG + Intergenic
1088013229 11:105028974-105028996 AAATTGCTCTCTTGGATAAAGGG + Intronic
1089829748 11:121316549-121316571 AGACTGTTTTAGTGGAAATAAGG + Intergenic
1089840465 11:121413124-121413146 AAACTGGTCCAGTTGATACAGGG + Intergenic
1091144098 11:133262272-133262294 AATCTGTTCTCCAGGATAAATGG + Intronic
1094528711 12:31251731-31251753 AAACTCTTCTAGTCTATAATTGG + Intergenic
1095325320 12:40884124-40884146 AAACTGTTTTACTTGCTAAATGG - Intronic
1095536565 12:43255631-43255653 AAAATGTGCTAATGGATTAATGG + Intergenic
1097753062 12:63378974-63378996 AAACTGATCAAGTGGAAGAAAGG + Intergenic
1102843960 12:116157788-116157810 AAACTGTACTTCTGGAGAAAGGG + Intronic
1104275901 12:127327638-127327660 AATTTGTTCTGCTGGATAAAAGG - Intergenic
1104425256 12:128671588-128671610 AAACTGTTGAGGTGGATAAATGG + Intronic
1105316085 13:19265109-19265131 AAACGTTTCTAGTGGACAATTGG - Intergenic
1106814393 13:33390862-33390884 AAACTTATCTAGAGGAGAAAAGG - Intergenic
1107728878 13:43328222-43328244 AACCTGTTCCAGTGGATCACCGG + Intronic
1108026868 13:46187154-46187176 AAACTGTTCTGGAGGATGATGGG - Intronic
1112615781 13:101003846-101003868 AGACTGTTCTAGCAAATAAAAGG + Intergenic
1113038743 13:106081233-106081255 AAACTGTGCTAGTGTTTCAATGG - Intergenic
1116065378 14:39975138-39975160 AAGCTGATATAGTTGATAAAAGG + Intergenic
1117822002 14:59659106-59659128 AAACTGATCAAGTGGAAGAAAGG + Intronic
1119252257 14:73166798-73166820 AAACTATTCTAAAGCATAAAAGG - Intronic
1120109624 14:80539118-80539140 ACACTGTTCTAGAGGTGAAAAGG + Intronic
1124220310 15:27845457-27845479 AAACTCTTTCAGTGGATGAAAGG + Intronic
1124427978 15:29579229-29579251 ACACTTTGCTTGTGGATAAATGG + Intergenic
1125784443 15:42302726-42302748 AAACTGATCAAGTGGAAGAAAGG + Intronic
1126208016 15:46068473-46068495 AAACTGTTGTAGTAAAAAAAGGG + Intergenic
1126390410 15:48143604-48143626 AAACTGTGATATTGAATAAACGG - Intronic
1126841151 15:52718570-52718592 AAACTGTCCTTGAGAATAAAAGG + Intergenic
1129040066 15:72678266-72678288 AAGCTGTTCTAGTGGATCCCAGG - Intronic
1129942579 15:79511113-79511135 AAAATGTTGTACTGGAGAAAAGG - Intergenic
1130076284 15:80693753-80693775 AAATTGTTTTAGTGAAGAAATGG + Intronic
1133426141 16:5691390-5691412 ACACTGCCCTAGTGGACAAATGG - Intergenic
1134276064 16:12777285-12777307 AAACTGTTCTAAAGGCTCAAAGG + Intronic
1136987940 16:35129112-35129134 AAACTGTTCTAGTAGAGTGATGG - Intergenic
1139231790 16:65290482-65290504 AAACTTTTATAGTGGAGCAAAGG + Intergenic
1140462042 16:75147738-75147760 AAACTGTTCTAAAGGATGAAAGG + Intergenic
1141322421 16:83024216-83024238 AAACTTTTTTAGTGGATACAAGG + Intronic
1142788417 17:2243844-2243866 AAACTGGTCTAGTGGAAGACTGG + Intronic
1143661773 17:8328926-8328948 AAACTGGTTTAAGGGATAAAGGG - Intergenic
1146636972 17:34513734-34513756 CTACTGTTCTTGTGTATAAATGG + Intergenic
1149170446 17:53803783-53803805 AAAATTTTCTAGTTGATAATTGG + Intergenic
1149225770 17:54468505-54468527 AAACTGTGCTGGTTGAAAAAGGG - Intergenic
1149410031 17:56395512-56395534 AAATTGTTCTAGAGGACCAATGG + Intronic
1149842113 17:59974690-59974712 AAACTGGGGGAGTGGATAAAAGG - Intergenic
1150907712 17:69355802-69355824 ATACTCTTGTAGTGGATAAAAGG + Intergenic
1151547817 17:74804082-74804104 AGACTGATCTACAGGATAAAAGG - Intronic
1156604190 18:38646336-38646358 TAAATGTTCTAGTGGAAGAAGGG + Intergenic
1159671305 18:71224383-71224405 AAACATTTGTAGTGAATAAAGGG - Intergenic
1164345684 19:27253535-27253557 AGAATGTGCTAGTGGATAATTGG + Intergenic
1165987309 19:39781412-39781434 AAACTGTATTAGTGCATAATGGG - Intronic
925374896 2:3377461-3377483 AAACGGTTGTACTGGATAACAGG - Intronic
927876902 2:26663191-26663213 ATACTGTTATGGTGGATATAGGG - Intergenic
929474680 2:42234145-42234167 AAAGTGTTCTATTTTATAAAAGG - Intronic
930138672 2:47929319-47929341 AAACTGTTAAAGTGCATAAGTGG - Intergenic
930363057 2:50406281-50406303 AATCTGTTCTAATAAATAAAGGG + Intronic
930685681 2:54305841-54305863 AAACTGTCCAAGTAGAGAAAGGG - Intergenic
930690927 2:54363466-54363488 TAACTTTTCAAGTTGATAAATGG + Intronic
931101658 2:59008754-59008776 AAACTGTTCTATTTTTTAAATGG + Intergenic
931307234 2:61041591-61041613 AAACTGTAGCAGAGGATAAAGGG + Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931877733 2:66532045-66532067 AACCAGTTTTAGTGGGTAAAAGG + Intronic
932506761 2:72241106-72241128 TAAGGGTTCTAGTGGAAAAATGG + Intronic
933444178 2:82356014-82356036 ATACTGTAATAGTGGATACATGG - Intergenic
935230807 2:101094248-101094270 AAACCTGTCTACTGGATAAAGGG + Intronic
935343901 2:102086079-102086101 TAGCAGTGCTAGTGGATAAAAGG - Intronic
936276853 2:111106681-111106703 ACACTGTTCCAGTGGGGAAAAGG + Intronic
936727439 2:115337303-115337325 GAAGGGTTCTAGTGGCTAAAAGG + Intronic
937943085 2:127304350-127304372 AAAATGTTGTATTGAATAAAAGG - Exonic
938318941 2:130349463-130349485 AAACTGGTGGAGTGGATACAGGG - Intergenic
938504522 2:131863754-131863776 ATACTGTAATAGTGGATACATGG - Intergenic
938805100 2:134799556-134799578 AAAATATTCCAGTGGAAAAATGG - Intergenic
938855339 2:135304702-135304724 AAATTTTTCTAGTTGATACAGGG + Intronic
938916442 2:135945797-135945819 AAATTGTTCTACTGAATCAACGG + Intronic
939007108 2:136801929-136801951 AAACTGTTATTGTGGGGAAATGG + Intronic
940136450 2:150441311-150441333 AGACTGTACCAGTGGCTAAATGG - Intergenic
940405483 2:153296302-153296324 AAACTGTAATAGTGAATAGAAGG + Intergenic
940552442 2:155177646-155177668 AAATTGTTATAGTGGATATTTGG - Intergenic
940968367 2:159866234-159866256 AAAATGTACTAGTGAATCAAAGG + Intronic
941162436 2:162051447-162051469 AAACTGTTTTGGTAAATAAATGG + Intronic
941386767 2:164862117-164862139 AATATGTTTTAGTTGATAAAAGG + Intergenic
941392028 2:164926329-164926351 AAGCTGTGCCAGTGTATAAAAGG - Intronic
943603313 2:189946597-189946619 AAAATGTTTTAATGGCTAAAAGG - Intronic
944652883 2:201849423-201849445 AAACTCTTCAAATGTATAAAAGG - Intronic
945165277 2:206936622-206936644 ACATTGTTCTAGGGGAAAAAGGG - Intergenic
948304964 2:236940030-236940052 AAAATGTTCTAGTGATTAATGGG + Intergenic
948844747 2:240677651-240677673 ATACTGAACTTGTGGATAAAGGG + Intronic
948849113 2:240697228-240697250 ATACTGAACTTGTGGATAAAGGG - Intronic
1172495554 20:35380994-35381016 AACCTGTTCTAGGAGATAAGTGG + Intronic
1173708164 20:45129484-45129506 AAACAATTGTAGTGGATTAAAGG - Intergenic
1175212563 20:57370215-57370237 AAACAGTTCTGGTGGAACAATGG - Intronic
1175489129 20:59367052-59367074 AGACACTTCTAGTGGATATAAGG - Intergenic
1176792520 21:13335608-13335630 ATACTGTAATAGTGGATACATGG + Intergenic
1176946459 21:14988227-14988249 AAACTGTTGTATTAAATAAAAGG + Intronic
1178933238 21:36837955-36837977 AAACTTATCAAGTGTATAAATGG - Intronic
1182306860 22:29375826-29375848 GAACTGTTCTGGTGGAAAGAAGG + Intronic
950470512 3:13182430-13182452 GCACTGTTCTAATGGGTAAAAGG + Intergenic
951201687 3:19882264-19882286 ATACTATTCTAGTTGAGAAAAGG - Intronic
954184743 3:48908251-48908273 AAACTGTTTTCATTGATAAAAGG + Intergenic
954525104 3:51262791-51262813 AAACTGATCAAGTGGAAGAAAGG + Intronic
955459571 3:59166291-59166313 AAACTGGACTATTTGATAAATGG + Intergenic
957812909 3:85251114-85251136 TTACTGTTCTAGTAGAAAAATGG - Intronic
958959944 3:100499922-100499944 AAACTATTCTTGTGGTCAAATGG + Intronic
959166392 3:102784441-102784463 AACCTGTTCTGCTGGATATAAGG + Intergenic
960476042 3:118129902-118129924 AAACCTTTATAGTGGAAAAAGGG - Intergenic
961626822 3:128269750-128269772 AAACTGTTCTAGGGACTAAATGG - Intronic
962657194 3:137559388-137559410 TAACTGTACTTGTGGATATATGG + Intergenic
963629152 3:147711928-147711950 AAACTGATCAAGTGGAAGAAAGG - Intergenic
965621795 3:170649912-170649934 AAATTGATCAAGTGGAAAAAAGG - Intronic
967287439 3:187886975-187886997 AATCTCTTCTAGAAGATAAAAGG - Intergenic
970337394 4:15063126-15063148 AAACTGTTATATTGGGGAAAAGG - Intronic
970715687 4:18919765-18919787 AATCAGTTCTAGTGGGTAATAGG + Intergenic
970782954 4:19760795-19760817 AAAGTCTTCTAGGGGAGAAAAGG - Intergenic
971132383 4:23827082-23827104 AAACTGTTCTAGTGCTTATGAGG + Intronic
971497564 4:27283420-27283442 AAACAGTTCTTTTGGATAACTGG - Intergenic
973995935 4:56458637-56458659 ACTCTGTTCTTGTGGATAATGGG + Intronic
974086533 4:57266939-57266961 AAAATGAACTAGTGAATAAAAGG + Intergenic
975084421 4:70320506-70320528 TAACTGTTCTCATGGAAAAAAGG - Intergenic
976526532 4:86098585-86098607 CTCCTGTTCTAGTGGATATATGG - Exonic
976663954 4:87570498-87570520 TAACTGTTCCAGTGTAGAAACGG - Intergenic
977723334 4:100266540-100266562 AAATTGATCGAGTGGAAAAAAGG - Intergenic
979075591 4:116265527-116265549 AAACTTTGCTAGTGGATCACAGG - Intergenic
982331194 4:154183861-154183883 AAACTGTGCTACAGGAGAAAAGG + Intergenic
982811758 4:159834410-159834432 TAGCTGTTCTATTGGTTAAATGG + Intergenic
984172463 4:176376940-176376962 AAACTGTTCTAGAGAAAAAAAGG + Intergenic
986396215 5:7333347-7333369 AAACTGTCCAAGTGGGCAAAGGG - Intergenic
986904342 5:12475840-12475862 AAAGTTTTATAGTGGAGAAAGGG + Intergenic
987726363 5:21705009-21705031 TAATTATTCTGGTGGATAAATGG - Intergenic
987949050 5:24652484-24652506 AAACTGTGTGGGTGGATAAATGG + Intergenic
989230080 5:39074817-39074839 AAAATGTTTCAGTGGATACACGG - Intergenic
989343079 5:40398697-40398719 AAATTGTCCTATTGGATAATTGG - Intergenic
990803650 5:59633109-59633131 AAACTGATCAAGTGGAAGAAAGG + Intronic
992142346 5:73811601-73811623 AAACTCTTTTACTGGATATAAGG + Intronic
993237311 5:85329226-85329248 AAACTATTCTGCTGTATAAATGG - Intergenic
994015183 5:94956639-94956661 AAACTGATCAAGTGGAAGAAAGG + Intronic
997533147 5:134595070-134595092 AAACTGGTTTAGTGGAGAAGGGG - Intergenic
997657050 5:135563036-135563058 AAATTTTTCTAGTGGATATAAGG + Intergenic
998123633 5:139600305-139600327 AAACTTTAGTAATGGATAAAAGG + Intronic
1001383240 5:171317658-171317680 GAACTGTTTTAGGGGATCAATGG - Intergenic
1003037872 6:2660967-2660989 AGACTGTTCCTGTGGGTAAAGGG + Intergenic
1004097696 6:12575005-12575027 AAAATATTCTAGGGGATAAAGGG - Intergenic
1004800809 6:19145118-19145140 AAGCTGTTCTGTTAGATAAAAGG - Intergenic
1005169127 6:22961362-22961384 AAACTTTTCTATTGGATCAAAGG + Intergenic
1005501110 6:26430006-26430028 ACACTGTCCTGGAGGATAAAGGG - Intergenic
1005505663 6:26467154-26467176 ACACTGTCCTGGAGGATAAAGGG - Intronic
1007013308 6:38438360-38438382 AAACCGTTGAAGTGGAGAAATGG + Intronic
1007493890 6:42245726-42245748 AAACTGTGCTACTGGGTAGAGGG + Intronic
1008439084 6:51511698-51511720 AAACTGTAATAGTGAATGAATGG - Intergenic
1008508137 6:52250913-52250935 AAAATGTTTAACTGGATAAAAGG + Intergenic
1009046025 6:58238264-58238286 AAAGTGTTATAGTGGAAAAAAGG + Intergenic
1009221837 6:60992575-60992597 AAAGTGTTATAGTGGAAAAAAGG + Intergenic
1011324269 6:86131751-86131773 AGAATTTTCTACTGGATAAATGG - Intergenic
1013025186 6:106264216-106264238 AAACTGATCAAGTGGAAGAAAGG + Intronic
1014560492 6:122884080-122884102 AAACTGATCCAGTGGAAGAAAGG - Intergenic
1014771473 6:125462727-125462749 AAAGGGTTCTAGTGGAAATAAGG - Intergenic
1014844722 6:126261533-126261555 AAACTATTCTACTAGATACACGG - Intergenic
1016786466 6:148015984-148016006 AAACTGTTCTAGTCAAGAAAAGG - Intergenic
1018046060 6:159967842-159967864 AAAGTGTTGTAGTGGGTCAAAGG - Intergenic
1018265052 6:162015214-162015236 AAACTGTGGCAGTGGAGAAAAGG + Intronic
1019935811 7:4256855-4256877 AAAATGTCCTGGGGGATAAAAGG - Intronic
1020705067 7:11533899-11533921 AAACTGTTATAGGGCAGAAATGG + Intronic
1020915851 7:14191667-14191689 AAACTCTTCTGGGGGACAAAGGG + Intronic
1023559371 7:41457805-41457827 AAACTGTTCTAGTGCTGAAAGGG + Intergenic
1025323266 7:58172639-58172661 AAACTCTGCAAGTGGATATATGG + Intergenic
1025323287 7:58172979-58173001 AAAGTGTGCAAGTGGATATATGG + Intergenic
1025324165 7:58188647-58188669 AAAATCTGCAAGTGGATAAAAGG + Intergenic
1025324197 7:58189327-58189349 AAACTCTGCAAGTGGATATATGG + Intergenic
1025325390 7:58210782-58210804 AAACTCTGCAAGTGGATATATGG + Intergenic
1025326257 7:58226112-58226134 AAACTCTGCAAGTGGATATATGG + Intergenic
1025328196 7:58260517-58260539 AAACTCTGCAAGTGGATATATGG + Intergenic
1025328771 7:58270742-58270764 AAACTCTGCAAGTGGATATATGG + Intergenic
1025329777 7:58288521-58288543 AAACTCTGCAAGTGGATATATGG + Intergenic
1025329877 7:58290222-58290244 AAACTCTGCAAGTGGATATATGG + Intergenic
1025331845 7:58324979-58325001 AAACTCTGCAAGTGGATATATGG + Intergenic
1025332186 7:58331108-58331130 AAACTCTGCAAGTGGATATATGG + Intergenic
1025332816 7:58342356-58342378 AAACTCTGCAAGTGGATATATGG + Intergenic
1025334154 7:58365770-58365792 AAACTCTGCAAGTGGATATATGG + Intergenic
1025334543 7:58372578-58372600 AAACTCTGCAAGTGGATATATGG + Intergenic
1025334682 7:58374962-58374984 AAACTCTGCAAGTGGATATATGG + Intergenic
1025335637 7:58391992-58392014 AAACTCTGCAAGTGGATATATGG + Intergenic
1025335696 7:58393014-58393036 AAACTCTGCAAGTGGATATATGG + Intergenic
1025336245 7:58402554-58402576 AAACTCTGCAAGTGGATATATGG + Intergenic
1025336304 7:58403577-58403599 AAACTCTGCAAGTGGATATATGG + Intergenic
1025337427 7:58423677-58423699 AAACTCTGCAAGTGGATATATGG + Intergenic
1025337486 7:58424699-58424721 AAACTCTGCAAGTGGATATATGG + Intergenic
1025337778 7:58429809-58429831 AAACTCTGCAAGTGGATATATGG + Intergenic
1025339676 7:58463530-58463552 AAACTCTGCAAGTGGATATATGG + Intergenic
1025340275 7:58474090-58474112 AAACTCTGCAAGTGGATATATGG + Intergenic
1025340662 7:58480906-58480928 AAACTCTGCAAGTGGATATATGG + Intergenic
1025340777 7:58482950-58482972 AAACTCTGCAAGTGGATATATGG + Intergenic
1025341986 7:58504415-58504437 AAACTCTGCAAGTGGATATATGG + Intergenic
1025342386 7:58511569-58511591 AAACTCTGCAAGTGGATATATGG + Intergenic
1025343290 7:58527580-58527602 AAACTCTGCAAGTGGATATATGG + Intergenic
1025343346 7:58528602-58528624 AAACTCTGCAAGTGGATATATGG + Intergenic
1025343753 7:58535755-58535777 AAACTCTGCAAGTGGATATATGG + Intergenic
1025344315 7:58545633-58545655 AAACTCTGCAAGTGGATATATGG + Intergenic
1025345096 7:58559596-58559618 AAACTCTGCAAGTGGATATATGG + Intergenic
1025345580 7:58568112-58568134 AAACTCTGCAAGTGGATATATGG + Intergenic
1025345756 7:58571178-58571200 AAACTCTGCAAGTGGATATATGG + Intergenic
1025346672 7:58587535-58587557 AAACTCTGCAAGTGGATATATGG + Intergenic
1025346966 7:58592647-58592669 AAACTCTGCAAGTGGATATATGG + Intergenic
1025347254 7:58597758-58597780 AAACTCTGCAAGTGGATATATGG + Intergenic
1025347370 7:58599800-58599822 AAACTCTGCAAGTGGATATATGG + Intergenic
1025347468 7:58601503-58601525 AAACTCTGCAAGTGGATATATGG + Intergenic
1025347584 7:58603545-58603567 AAACTCTGCAAGTGGATATATGG + Intergenic
1025348487 7:58619554-58619576 AAACTCTGCAAGTGGATATATGG + Intergenic
1025350111 7:58648513-58648535 AAACTCTGCAAGTGGATATATGG + Intergenic
1025351027 7:58664864-58664886 AAACTCTGCAAGTGGATATATGG + Intergenic
1025351085 7:58665886-58665908 AAACTCTGCAAGTGGATATATGG + Intergenic
1025351316 7:58669971-58669993 AAACTCTGCAAGTGGATATATGG + Intergenic
1025351833 7:58679170-58679192 AAACTCTGCAAGTGGATATATGG + Intergenic
1025352183 7:58685309-58685331 AAAGTCTGCTAGTGGATATATGG + Intergenic
1025353544 7:58709155-58709177 AAACTCTGCAAGTGGATATATGG + Intergenic
1025353812 7:58713926-58713948 AAACTCTGCAAGTGGATATATGG + Intergenic
1025353870 7:58714948-58714970 AAACTCTGCAAGTGGATATATGG + Intergenic
1025354101 7:58719037-58719059 AAACTCTGCAAGTGGATATATGG + Intergenic
1025354159 7:58720059-58720081 AAACTCTGCAAGTGGATATATGG + Intergenic
1025354238 7:58721421-58721443 AAACTCTGCAAGTGGATATATGG + Intergenic
1025354351 7:58723465-58723487 AAACTCTGCAAGTGGATATATGG + Intergenic
1025356661 7:58764103-58764125 AAAGTCTGCTAGTGGATATATGG + Intergenic
1025356714 7:58765125-58765147 AAACTCTGCAAGTGGATATATGG + Intergenic
1025356773 7:58766147-58766169 AAACTCTGCAAGTGGATATATGG + Intergenic
1025357308 7:58775682-58775704 AAACTCTGCAAGTGGATATATGG + Intergenic
1025357651 7:58781816-58781838 AAACTCTGCAAGTGGATATATGG + Intergenic
1025357881 7:58785907-58785929 AAACTCTGCAAGTGGATATATGG + Intergenic
1025358780 7:58801924-58801946 AAACTCTGCAAGTGGATATATGG + Intergenic
1025360191 7:58827135-58827157 AAACTCTGCAAGTGGATATATGG + Intergenic
1025360778 7:58837356-58837378 AAACTCTGCAAGTGGATATATGG + Intergenic
1025360952 7:58840422-58840444 AAACTCTGCAAGTGGATATATGG + Intergenic
1025362203 7:58862568-58862590 AAACTCTGCAAGTGGATATATGG + Intergenic
1025362433 7:58866658-58866680 AAACTCTGCAAGTGGATATATGG + Intergenic
1025364349 7:58900726-58900748 AAACTCTGCAAGTGGATATATGG + Intergenic
1025364463 7:58902771-58902793 AAACTCTGCAAGTGGATATATGG + Intergenic
1025364770 7:58908223-58908245 AAACTCTGCAAGTGGATATATGG + Intergenic
1025365116 7:58914354-58914376 AAACTCTGCAAGTGGATATATGG + Intergenic
1025365541 7:58921849-58921871 AAACTCTGCAAGTGGATATATGG + Intergenic
1025365770 7:58925936-58925958 AAACTCTGCAAGTGGATATATGG + Intergenic
1025365828 7:58926958-58926980 AAACTCTGCAAGTGGATATATGG + Intergenic
1025367099 7:58949442-58949464 AAACTCTGCAAGTGGATATATGG + Intergenic
1025367214 7:58951486-58951508 AAACTCTGCAAGTGGATATATGG + Intergenic
1025368411 7:58972608-58972630 AAAGTCTGCTAGTGGATATATGG + Intergenic
1025368544 7:58974993-58975015 AAACTCTGCAAGTGGATATATGG + Intergenic
1025370029 7:59001224-59001246 AAACTCTGCAAGTGGATATATGG + Intergenic
1025371004 7:59018597-59018619 AAACTCTGCAAGTGGATATATGG + Intergenic
1025371197 7:59022003-59022025 AAACTCTGCAAGTGGATATATGG + Intergenic
1025371542 7:59028137-59028159 AAACTCTGCAAGTGGATATATGG + Intergenic
1025371927 7:59034950-59034972 AAACTCTGCAAGTGGATATATGG + Intergenic
1025372623 7:59047217-59047239 AAACTCTGCAAGTGGATATATGG + Intergenic
1025373957 7:59071065-59071087 AAACTCTGCAAGTGGATATATGG + Intergenic
1025375021 7:59089799-59089821 AAACTCTGCAAGTGGATATATGG + Intergenic
1025375635 7:59100714-59100736 AAACTCTGCAAGTGGATATATGG + Intergenic
1025376942 7:59123879-59123901 AAACTCTGCAAGTGGATATATGG + Intergenic
1025377055 7:59125924-59125946 AAACTCTGCAAGTGGATATATGG + Intergenic
1025377112 7:59126946-59126968 AAACTCTGCAAGTGGATATATGG + Intergenic
1025378015 7:59142953-59142975 AAACTCTGCAAGTGGATATATGG + Intergenic
1025378492 7:59151467-59151489 AAACTCTGCAAGTGGATATATGG + Intergenic
1025378607 7:59153511-59153533 AAACTCTGCAAGTGGATATATGG + Intergenic
1025379641 7:59171907-59171929 AAACTCTGCAAGTGGATATATGG + Intergenic
1025381031 7:59196437-59196459 AAACTCTGCAAGTGGATATATGG + Intergenic
1025382306 7:59218928-59218950 AAACTCTGCAAGTGGATATATGG + Intergenic
1025384096 7:59250937-59250959 AAACTCTGCAAGTGGATATATGG + Intergenic
1025385557 7:59276824-59276846 AAACTCTGCAAGTGGATATATGG + Intergenic
1025386329 7:59290448-59290470 AAACTCTGCAAGTGGATATATGG + Intergenic
1025386735 7:59297599-59297621 AAACTCTGCAAGTGGATATATGG + Intergenic
1025389694 7:59350391-59350413 AAACTCTGCAAGTGGATATATGG + Intergenic
1025389752 7:59351413-59351435 AAACTCTGCAAGTGGATATATGG + Intergenic
1025390820 7:59370487-59370509 AAACTCTGCAAGTGGATATATGG + Intergenic
1025391161 7:59376622-59376644 AAACTCTGCAAGTGGATATATGG + Intergenic
1025391470 7:59382073-59382095 AAACTCTGCAAGTGGATATATGG + Intergenic
1025391527 7:59383095-59383117 AAACTCTGCAAGTGGATATATGG + Intergenic
1025391814 7:59388206-59388228 AAACTCTGCAAGTGGATATATGG + Intergenic
1025392778 7:59405235-59405257 AAACTCTGCAAGTGGATATATGG + Intergenic
1025392949 7:59408301-59408323 AAACTCTGCAAGTGGATATATGG + Intergenic
1025393583 7:59419541-59419563 AAACTCTGCAAGTGGATATATGG + Intergenic
1025393873 7:59424651-59424673 AAACTCTGCAAGTGGATATATGG + Intergenic
1025394276 7:59431819-59431841 AAACTCTGCAAGTGGATATATGG + Intergenic
1025395769 7:59458382-59458404 AAACTCTGCAAGTGGATATATGG + Intergenic
1025396398 7:59469620-59469642 AAACTCTGCAAGTGGATATATGG + Intergenic
1025397064 7:59481542-59481564 AAACTCTGCAAGTGGATATATGG + Intergenic
1025397505 7:59489379-59489401 AAACTCTGCAAGTGGATATATGG + Intergenic
1025397720 7:59493125-59493147 AAACTCTGCAAGTGGATATATGG + Intergenic
1025397836 7:59495171-59495193 AAACTCTGCAAGTGGATATATGG + Intergenic
1025398435 7:59505734-59505756 AAACTCTGCAAGTGGATATATGG + Intergenic
1025398983 7:59515132-59515154 AAACTCTGCAAGTGGATATATGG + Intergenic
1025399154 7:59518199-59518221 AAACTCTGCAAGTGGATATATGG + Intergenic
1025399211 7:59519222-59519244 AAACTCTGCAAGTGGATATATGG + Intergenic
1025399269 7:59520244-59520266 AAACTCTGCAAGTGGATATATGG + Intergenic
1025400077 7:59534548-59534570 AAACTCTGCAAGTGGATATATGG + Intergenic
1025400271 7:59537955-59537977 AAACTCTGCAAGTGGATATATGG + Intergenic
1025400794 7:59547152-59547174 AAACTCTGCAAGTGGATATATGG + Intergenic
1025401677 7:59562818-59562840 AAACTCTGCAAGTGGATATATGG + Intergenic
1025402008 7:59568608-59568630 AAACTCTGCAAGTGGATATATGG + Intergenic
1025402470 7:59576784-59576806 AAACTCTGCAAGTGGATATATGG + Intergenic
1025403031 7:59586661-59586683 AAACTCTGCAAGTGGATATATGG + Intergenic
1025403242 7:59590410-59590432 AAACTCTGCAAGTGGATATATGG + Intergenic
1025404589 7:59614260-59614282 AAACTCTGCAAGTGGATATATGG + Intergenic
1025404916 7:59620048-59620070 AAACTCTGCAAGTGGATATATGG + Intergenic
1025405087 7:59623114-59623136 AAACTCTGCAAGTGGATATATGG + Intergenic
1025406339 7:59645254-59645276 AAACTCTGCAAGTGGATATATGG + Intergenic
1025406797 7:59653432-59653454 AAACTCTGCAAGTGGATATATGG + Intergenic
1025407206 7:59660586-59660608 AAACTCTGCAAGTGGATATATGG + Intergenic
1025407496 7:59665699-59665721 AAACTCTGCAAGTGGATATATGG + Intergenic
1025408410 7:59682053-59682075 AAACTCTGCAAGTGGATATATGG + Intergenic
1025409493 7:59701127-59701149 AAACTCTGCAAGTGGATACATGG + Intergenic
1025410995 7:59727700-59727722 AAACTCTGCAAGTGGATATATGG + Intergenic
1025412218 7:59749507-59749529 AAACTCTGCAAGTGGATATATGG + Intergenic
1025413007 7:59763482-59763504 AAACTCTGCAAGTGGATATATGG + Intergenic
1025413065 7:59764501-59764523 AAACTCTGCAAGTGGATATATGG + Intergenic
1025413180 7:59766545-59766567 AAACTCTGCAAGTGGATATATGG + Intergenic
1025413354 7:59769611-59769633 AAACTCTGCAAGTGGATATATGG + Intergenic
1025413813 7:59777787-59777809 AAAGTCTGCTAGTGGATATATGG + Intergenic
1025413870 7:59778809-59778831 AAACTCTGCAAGTGGATATATGG + Intergenic
1025414964 7:59798229-59798251 AAACTCTGCAAGTGGATATATGG + Intergenic
1025415077 7:59800273-59800295 AAACTCTGCAAGTGGATATATGG + Intergenic
1025415306 7:59804362-59804384 AAACTCTGCAAGTGGATATATGG + Intergenic
1025416802 7:59830938-59830960 AAACTCTGCAAGTGGATATATGG + Intergenic
1025418888 7:59868069-59868091 AAACTCTGCAAGTGGATATATGG + Intergenic
1025420219 7:59891580-59891602 AAACTCTGCAAGTGGATATATGG + Intergenic
1025420337 7:59893628-59893650 AAACTCTGCAAGTGGATATATGG + Intergenic
1025420800 7:59901804-59901826 AAACTCTGCAAGTGGATATATGG + Intergenic
1025421396 7:59912363-59912385 AAACTCTGCAAGTGGATATATGG + Intergenic
1025422842 7:59938251-59938273 AAAGTCTTCAAGTGGATATATGG + Intergenic
1025423094 7:59942679-59942701 AAACTCTGCAAGTGGATATATGG + Intergenic
1025423589 7:59951536-59951558 AAACTCTGCAAGTGGATATATGG + Intergenic
1025423987 7:59958691-59958713 AAACTCTGCAAGTGGATATATGG + Intergenic
1025424217 7:59962784-59962806 AAACTCTGCAAGTGGATATATGG + Intergenic
1025424696 7:59971302-59971324 AAACTCTGCAAGTGGATATATGG + Intergenic
1025425605 7:59987326-59987348 AAACTCTGCAAGTGGATATATGG + Intergenic
1025426785 7:60008452-60008474 AAACTCTGCAAGTGGATATATGG + Intergenic
1025427244 7:60016624-60016646 AAACTCTGCAAGTGGATATATGG + Intergenic
1025427644 7:60023775-60023797 AAACTCTGCAAGTGGATATATGG + Intergenic
1025428030 7:60030585-60030607 AAACTCTGCAAGTGGATATATGG + Intergenic
1025428243 7:60034331-60034353 AAACTCTGCAAGTGGATATATGG + Intergenic
1025428811 7:60044540-60044562 AAAGTCTTCAAGTGGATATATGG + Intergenic
1025429428 7:60055445-60055467 AAACTCTGCAAGTGGATATATGG + Intergenic
1025430198 7:60069069-60069091 AAACTCTGCAAGTGGATATATGG + Intergenic
1025430433 7:60073160-60073182 AAACTCTGCAAGTGGATATATGG + Intergenic
1025431251 7:60087807-60087829 AAACTCTGCAAGTGGATATATGG + Intergenic
1025431793 7:60097346-60097368 AAACTCTGCAAGTGGATATATGG + Intergenic
1025432056 7:60102116-60102138 AAACTCTGCAAGTGGATATATGG + Intergenic
1025433772 7:60132777-60132799 AAACTCTGCAAGTGGATATATGG + Intergenic
1025433947 7:60135845-60135867 AAACTCTGCAAGTGGATATATGG + Intergenic
1025434250 7:60141296-60141318 AAACTCTGCAAGTGGATATATGG + Intergenic
1025434596 7:60147430-60147452 AAACTCTGCAAGTGGATATATGG + Intergenic
1025434827 7:60151521-60151543 AAACTCTGCAAGTGGATATATGG + Intergenic
1025435230 7:60158668-60158690 AAACTCTGCAAGTGGATATATGG + Intergenic
1025436591 7:60182853-60182875 AAACTCTGCAAGTGGATATATGG + Intergenic
1025436649 7:60183875-60183897 AAACTCTGCAAGTGGATATATGG + Intergenic
1025436827 7:60186940-60186962 AAACTCTGCAAGTGGATATATGG + Intergenic
1025438847 7:60222727-60222749 AAACTCTGCAAGTGGATATATGG + Intergenic
1025438947 7:60224430-60224452 AAACTCTGCAAGTGGATATATGG + Intergenic
1025440229 7:60247256-60247278 AAACTCTGCAAGTGGATATATGG + Intergenic
1025442081 7:60280300-60280322 AAACTCTGCAAGTGGATATATGG + Intergenic
1025444368 7:60320847-60320869 AAACTCTGCAAGTGGATATATGG + Intergenic
1025444561 7:60324251-60324273 AAACTCTGCAAGTGGATATATGG + Intergenic
1025445622 7:60342988-60343010 AAACTCTGCAAGTGGATATATGG + Intergenic
1025446027 7:60350144-60350166 AAACTCTGCAAGTGGATATATGG + Intergenic
1025446195 7:60353210-60353232 AAACTCTGCAAGTGGATATATGG + Intergenic
1025449060 7:60404325-60404347 AAACTCTGCAAGTGGATATATGG + Intergenic
1025449501 7:60412160-60412182 AAACTCTGCAAGTGGATATATGG + Intergenic
1025450076 7:60422380-60422402 AAACTCTGCAAGTGGATATATGG + Intergenic
1025450192 7:60424424-60424446 AAACTCTGCAAGTGGATATATGG + Intergenic
1025450326 7:60426808-60426830 AAACTCTGCAAGTGGATATATGG + Intergenic
1025451901 7:60454745-60454767 AAACTCTGCAAGTGGATATATGG + Intergenic
1025453627 7:60485401-60485423 AAACTCTGCAAGTGGATATATGG + Intergenic
1025455924 7:60526295-60526317 AAACTCTGCAAGTGGATATATGG + Intergenic
1025456251 7:60532083-60532105 AAAATCTGCAAGTGGATAAAAGG + Intergenic
1025456641 7:60539239-60539261 AAACTCTGCAAGTGGATATATGG + Intergenic
1025456755 7:60541283-60541305 AAACTCTGCAAGTGGATATATGG + Intergenic
1025456871 7:60543328-60543350 AAACTCTGCAAGTGGATATATGG + Intergenic
1025456985 7:60545365-60545387 AAACTCTGCAAGTGGATATATGG + Intergenic
1025457272 7:60550474-60550496 AAACTCTGCAAGTGGATATATGG + Intergenic
1025457444 7:60553540-60553562 AAACTCTGCAAGTGGATATATGG + Intergenic
1025457672 7:60557628-60557650 AAACTCTGCAAGTGGATATATGG + Intergenic
1025458207 7:60567168-60567190 AAAGTCTGCTAGTGGATATATGG + Intergenic
1025459409 7:60588635-60588657 AAACTCTGCAAGTGGATATATGG + Intergenic
1025459636 7:60592723-60592745 AAACTCTGCAAGTGGATATATGG + Intergenic
1025462127 7:60637025-60637047 AAACTCTGCAAGTGGATATATGG + Intergenic
1025462944 7:60651676-60651698 AAAGTCTGCTAGTGGATATATGG + Intergenic
1025463844 7:60667694-60667716 AAACTCTGCAAGTGGATATATGG + Intergenic
1025464015 7:60670755-60670777 AAACTCTGCAAGTGGATATATGG + Intergenic
1025465153 7:60691197-60691219 AAACTCTGCAAGTGGATAAATGG + Intergenic
1025466118 7:60708572-60708594 AAACTCTGCAAGTGGATATATGG + Intergenic
1025466461 7:60714707-60714729 AAACTCTGCAAGTGGATATATGG + Intergenic
1025466519 7:60715732-60715754 AAACTCTGCAAGTGGATATATGG + Intergenic
1025467341 7:60730380-60730402 AAACTCTGCAAGTGGATATATGG + Intergenic
1025468191 7:60745368-60745390 AAACTCTGCAAGTGGATATATGG + Intergenic
1025468307 7:60747412-60747434 AAACTCTGCAAGTGGATATATGG + Intergenic
1025468599 7:60752525-60752547 AAACTCTGCAAGTGGATATATGG + Intergenic
1025469628 7:60770919-60770941 AAACTCTGCAAGTGGATATATGG + Intergenic
1025469686 7:60771941-60771963 AAACTCTGCAAGTGGATATATGG + Intergenic
1025469914 7:60776029-60776051 AAACTCTGCAAGTGGATATATGG + Intergenic
1025471750 7:60808742-60808764 AAACTCTGCAAGTGGATATATGG + Intergenic
1025520239 7:61719602-61719624 AAACTGTTCAATCAGATAAAAGG + Intergenic
1025544561 7:62148257-62148279 AAACTGTTCAATCAGATAAAAGG + Intergenic
1028081857 7:86587178-86587200 AAACTGATCAAGTGGAAGAAAGG + Intergenic
1030920528 7:115379361-115379383 AAAGTGGTCTAGTGAATGAATGG + Intergenic
1031187842 7:118505544-118505566 AAATTGTTATAGTGTATACATGG - Intergenic
1033457425 7:141515486-141515508 AATCTGTTCTATTGGATATGAGG + Intergenic
1033478519 7:141714901-141714923 AAACTGTACTATTCCATAAAGGG + Intronic
1033690760 7:143734506-143734528 AAACTCTTCAAGATGATAAAGGG + Intergenic
1038698885 8:29830955-29830977 AATCATTTATAGTGGATAAAAGG - Intergenic
1039623709 8:39025757-39025779 AAAATGTTCTTGGGGAAAAAAGG - Intronic
1040142030 8:43931222-43931244 AAATTCTTCAAGTGGATAATTGG + Intergenic
1040142747 8:43944273-43944295 AAACTGTTCTATTGAAAAGAAGG - Intergenic
1040271411 8:45950470-45950492 AAACTGTTCTATTGAAAAGAAGG - Intergenic
1043130871 8:76459314-76459336 AAACTTTTTTAGAAGATAAATGG - Intergenic
1044296037 8:90528432-90528454 AAACTGTTCTAGAGAAAAGAAGG - Intergenic
1044371219 8:91413311-91413333 AAAATGTTTTAGTAAATAAAAGG - Intergenic
1046023993 8:108700109-108700131 AAACTGCTCTAGGCCATAAATGG + Intronic
1046221728 8:111225814-111225836 AAGCTCTTCTTGTGGACAAAAGG + Intergenic
1046728056 8:117695601-117695623 AAACAGTTCTAGTGCATGTAGGG + Intergenic
1050166141 9:2766561-2766583 AAACAGTTCTGCTGGACAAATGG + Intronic
1050525140 9:6539941-6539963 AAACTGATCTGGGGGATAAATGG - Intronic
1055181929 9:73399247-73399269 AAACTATTCTGTAGGATAAATGG - Intergenic
1055322412 9:75095684-75095706 AAACTGTTACACTGGGTAAACGG - Intronic
1055879885 9:80988090-80988112 ATACTGTGCTAGGTGATAAAAGG + Intergenic
1057431965 9:95003452-95003474 AAAAAATTCTAGTGGGTAAAAGG + Intronic
1058197647 9:101998635-101998657 AAACAGTTCTAGAGGATGAGGGG + Intergenic
1058878027 9:109260968-109260990 AAACCTTTCCAGTGGATTAATGG + Intronic
1059659985 9:116391153-116391175 AAAGTGGTCATGTGGATAAATGG - Intronic
1059892812 9:118823310-118823332 AAACTATTCCAGTAGATTAATGG - Intergenic
1188499348 X:30808830-30808852 CCACAGTTCTGGTGGATAAAGGG + Intergenic
1191147965 X:57189155-57189177 AAACTGATCAAGTGGAAGAAAGG - Intergenic
1193669068 X:84361098-84361120 ATATTGTTACAGTGGATAAATGG + Intronic
1194571323 X:95557793-95557815 AAAATGTTCTAGTGGCTACTTGG + Intergenic
1195434550 X:104827894-104827916 AAACTGATCAAGTGGAAAAAAGG - Intronic