ID: 903317351

View in Genome Browser
Species Human (GRCh38)
Location 1:22518726-22518748
Sequence TGTAAACTGCTTGGAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903317351_903317359 28 Left 903317351 1:22518726-22518748 CCTTTCCCTCCAAGCAGTTTACA 0: 1
1: 0
2: 2
3: 24
4: 230
Right 903317359 1:22518777-22518799 AGGCTTCCAGATGAGAGATTTGG 0: 1
1: 0
2: 0
3: 22
4: 353
903317351_903317357 8 Left 903317351 1:22518726-22518748 CCTTTCCCTCCAAGCAGTTTACA 0: 1
1: 0
2: 2
3: 24
4: 230
Right 903317357 1:22518757-22518779 CAAAAAAATCCAGTTACAGTAGG 0: 1
1: 0
2: 1
3: 25
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903317351 Original CRISPR TGTAAACTGCTTGGAGGGAA AGG (reversed) Intronic
900801004 1:4737140-4737162 AGTAAACTGCAGGCAGGGAAAGG - Intronic
901108756 1:6778676-6778698 AGTAATCTGATTGGAGGGAGGGG - Intergenic
903317351 1:22518726-22518748 TGTAAACTGCTTGGAGGGAAAGG - Intronic
904052806 1:27650356-27650378 TGTCAGCTGCTTGGCAGGAAAGG - Intergenic
904468375 1:30721174-30721196 TGTAAGCTCCTAGGATGGAAAGG + Intronic
904499168 1:30904303-30904325 TGTAAAGTGCTTGGTGGGCGGGG + Intronic
905672372 1:39800005-39800027 TGCAAAGTGCTTGGATGGGATGG + Intergenic
905804157 1:40863811-40863833 TGTCAAATGCGTGGAGGGTAAGG - Intergenic
907400140 1:54220207-54220229 TGGAGACTGCTTGGAGAGGAGGG + Intronic
908437577 1:64121481-64121503 TGTAAACTGCCATGAGGGCAGGG + Intronic
908582099 1:65526296-65526318 TTTAATTTGCTTGCAGGGAAGGG - Intronic
908844841 1:68314259-68314281 TCTATTCTGCTTGGAGAGAAGGG + Intergenic
909266074 1:73559279-73559301 TGTGGACTGTTGGGAGGGAATGG + Intergenic
910494682 1:87813761-87813783 TGTAAACTCCTTGAAGACAAAGG - Intergenic
911049245 1:93655583-93655605 AGTATAGTGCTTGGAGGCAAAGG - Intronic
911182240 1:94871432-94871454 TGGAAAGTGCTGGGAGGGAGAGG - Intronic
911765692 1:101672061-101672083 TATAAACTGCTAGGAGGAAAGGG - Intergenic
913369376 1:118081393-118081415 GGTACACTGCATGGAGGGAATGG - Exonic
916575992 1:166066938-166066960 TGTAAACTGCATGCAGCGAAGGG + Intronic
916889923 1:169105448-169105470 TGTAAAATTCTTGGAGCCAAAGG - Intergenic
918439076 1:184547558-184547580 TGTACACTGCTTCGTGGGGAAGG - Intronic
919177376 1:194035518-194035540 TATAAACAGCTTGGAGTCAATGG + Intergenic
919553147 1:199017701-199017723 TGAAAACTGCTTAGATGTAACGG + Intergenic
920398784 1:205664386-205664408 TGGGAGCTGCTTGGAGGGAGAGG - Intronic
920442544 1:205990580-205990602 TAAAGACTGCTTGGAGGAAAAGG + Intronic
920718606 1:208365771-208365793 TGTAAGCTGCTTGAAAGCAAGGG + Intergenic
921914550 1:220592752-220592774 TCTCAACTGCTTGGAGTGTAAGG + Intronic
922296184 1:224251800-224251822 TGGAAATTGGTTAGAGGGAAGGG - Intronic
922460021 1:225808771-225808793 TGTGAACTATTTGGAGGGGAGGG + Intergenic
924625271 1:245692271-245692293 TGTAATCTAATTGGAGAGAAAGG + Intronic
924797671 1:247303993-247304015 TGTGGACTGCATGGAGGGCAGGG + Intronic
1064888716 10:20143516-20143538 TGTAAACTGCTTGATGCAAATGG + Intronic
1064891401 10:20178444-20178466 TGTAAACTTCATGGGGGGCAGGG - Intronic
1065162701 10:22939432-22939454 TGTAATTTGCTTGGAAGGCATGG + Intronic
1065718407 10:28598531-28598553 ATCAAACTGCATGGAGGGAAGGG - Intronic
1067214949 10:44293697-44293719 TGGAAACTGCCTGGAGGCCAGGG - Intronic
1070416543 10:76195475-76195497 TGAAAACTGCTTGGATTGCAGGG + Intronic
1071187416 10:83060472-83060494 GGTAAACTGCTGGGACTGAAGGG - Intergenic
1073184877 10:101609836-101609858 TGTAAACAGGTTGCAGGGAAAGG - Intergenic
1073424477 10:103447967-103447989 TCTGAAATGCTTGGAGGGCAAGG + Intronic
1074192754 10:111151842-111151864 TTCAAACCGTTTGGAGGGAAAGG + Intergenic
1077956882 11:7030625-7030647 TGTAAGCTCCATGGAGGTAAGGG + Intronic
1082090079 11:48081755-48081777 TGTAAAATGGGTGGGGGGAAGGG + Intronic
1086242237 11:84709055-84709077 TGGAAGCTGCTGTGAGGGAAGGG + Intronic
1086974475 11:93116650-93116672 TTGAAACTGCTAGGTGGGAAGGG + Intergenic
1089236955 11:117037366-117037388 TGTATGCTGCTTGAAGGCAAGGG - Intronic
1090289995 11:125534893-125534915 GGTAAAGTGCTTGGAGTAAAAGG - Intergenic
1090421095 11:126575438-126575460 TGTACAATACTGGGAGGGAAGGG + Intronic
1091893263 12:4079734-4079756 TGTAAACTGCTTAAATGTAAGGG - Intergenic
1092386866 12:8042436-8042458 ATTAAACTGATGGGAGGGAATGG - Intronic
1092574289 12:9762529-9762551 TGTAAGCTGCTTGAGGGCAAGGG + Intergenic
1093811637 12:23499373-23499395 TGTAAATTTCTTTGAGGGAAGGG - Intergenic
1095947545 12:47762173-47762195 TGCCACCTGCTTGAAGGGAATGG - Intronic
1096488511 12:52000417-52000439 TATAAACTCCTTGAAGGGCAGGG - Intergenic
1096756707 12:53805518-53805540 TCTAAACTTCTTGTTGGGAATGG + Intergenic
1097621083 12:61940479-61940501 TGAAAACTGCCTAGAGGGAGAGG + Intronic
1098313453 12:69170126-69170148 TTTAAACTTCTTGTAGAGAAGGG - Intergenic
1099144443 12:79022269-79022291 TTAAAACTGCTTGGAGACAAAGG + Intronic
1101494288 12:105238793-105238815 TGTATTCTGCTTGGGGGGACAGG - Intronic
1101615788 12:106335506-106335528 TGTAAACTCCTTGCAGGGCATGG + Intronic
1102479054 12:113208385-113208407 TGAAAACTGCTTCCAGTGAAAGG - Intronic
1102898833 12:116620328-116620350 TCTAAAGTGCTGGGAGGGACAGG - Intergenic
1104703008 12:130921511-130921533 TGAAAACTGCTCGGAGGAGATGG + Intergenic
1106226573 13:27790932-27790954 AGTAACCTGCATGGAGGGCATGG - Intergenic
1106500122 13:30320306-30320328 TATAAACTGCTTGAAGGTCAGGG - Intergenic
1106879952 13:34118190-34118212 TGTAAACTGCTTGTTGAAAATGG - Intergenic
1108259560 13:48643299-48643321 TGTAAACTGCTTTAAAGAAATGG - Intergenic
1108406335 13:50106539-50106561 TGTAACTTTCATGGAGGGAAAGG - Intronic
1109099059 13:58156204-58156226 TGTAAATAGTTTGGATGGAAAGG + Intergenic
1109560514 13:64043193-64043215 TGTCAACTGCTTGAAAGCAAGGG - Intergenic
1112762693 13:102709198-102709220 GGAAAGCTGCTTGTAGGGAAGGG - Intergenic
1113160654 13:107377012-107377034 CATAATCTGCTGGGAGGGAAGGG - Intronic
1117279112 14:54220150-54220172 TGCAAACAGCTTGCAGAGAAAGG - Intergenic
1118542660 14:66845998-66846020 TTTAAACTGCTTGAAGACAAGGG - Intronic
1118737558 14:68712995-68713017 TGTAAAGTGCTTGGAGCGTCAGG + Intronic
1118897543 14:69957908-69957930 TGTAAACTCCTTGAAGGCAGAGG - Intronic
1119609199 14:76047408-76047430 TTCCAACTGCTTGGAGAGAAAGG + Intronic
1120567957 14:86082492-86082514 AGTAAACTTGTTGGAGGGTATGG - Intergenic
1121567341 14:94920028-94920050 TGTAAAATGCATGGAGGAAGGGG + Intergenic
1122952204 14:105051176-105051198 TGGACACTTCTTGGCGGGAATGG + Exonic
1124655024 15:31500619-31500641 TGTAGACAGCTGGGAAGGAAAGG - Intronic
1126652810 15:50942551-50942573 TTTGAACTTCTTGGAAGGAAAGG + Intronic
1127238124 15:57078497-57078519 TGTAAGCTCCTTGAAGGCAAAGG + Intronic
1127628337 15:60802069-60802091 TGTACAATGCTTGGTGGGAGTGG + Intronic
1128675197 15:69603298-69603320 TGGAAATTGCTTAGTGGGAAGGG + Intergenic
1129152418 15:73697270-73697292 TGTAGACAGCTGGGAGAGAAGGG + Intronic
1130285470 15:82550913-82550935 TGTAAGGTGATGGGAGGGAATGG + Intronic
1132078552 15:98845023-98845045 TGTAAACTCCTTGGTGGGCCTGG - Intronic
1133006467 16:2884217-2884239 TGAAACCTGCTGGGAGGGTAAGG + Intronic
1133685189 16:8159749-8159771 TGTAAACTTCATGAAGGGCAGGG + Intergenic
1135018247 16:18942231-18942253 TATAAACTCCTTGGAGTTAAGGG - Intergenic
1135531570 16:23259045-23259067 TGCACACTGGCTGGAGGGAAGGG + Intergenic
1135624065 16:23980433-23980455 TGCAAACTGTTTGGTGGAAAAGG - Intronic
1136057250 16:27699471-27699493 TGTGAACAGCATGGAGTGAATGG + Intronic
1137341513 16:47611509-47611531 TGGAAACTGCCTGAAGAGAAAGG + Intronic
1137917716 16:52450920-52450942 AGTAAACTGGTGGCAGGGAAAGG + Intronic
1139609906 16:68048534-68048556 TGAATACTGCATGGAGAGAATGG + Intronic
1140289139 16:73634287-73634309 TGAAAACTTCTCTGAGGGAAAGG - Intergenic
1140878631 16:79176930-79176952 TGGAAACTGATGAGAGGGAAAGG - Intronic
1144940010 17:18932364-18932386 AGGAAACAGCTTTGAGGGAAAGG + Intergenic
1146087223 17:29840770-29840792 TGTAAAGTGCTTAGAGGGCCTGG - Intronic
1147268430 17:39248983-39249005 TGTAGGCTGCTTGGAGGGTGAGG + Intergenic
1150802496 17:68292507-68292529 TGGAAACTGCTCGGAAGCAAAGG + Intronic
1153250760 18:3119237-3119259 TGGAAAATGCTTAGAGAGAAAGG + Intronic
1153709276 18:7781606-7781628 TGGGGACTGCTTGGGGGGAATGG - Intronic
1153986819 18:10357996-10358018 TGGAAACTCCTTGCAGGCAATGG - Intergenic
1154030095 18:10746003-10746025 GGAAAACTGCTTGGAAGGAAGGG - Intronic
1156685432 18:39639668-39639690 TATAAACTGTTTGGGGGAAAAGG - Intergenic
1158511260 18:58092563-58092585 GATAAACTGCTTAGAGTGAATGG + Intronic
1159219119 18:65437067-65437089 TGTAAACTGTTTCAAGTGAATGG + Intergenic
1159704128 18:71665571-71665593 AGGAAAATGCTTGGAGGGGAGGG - Intergenic
1160385878 18:78495953-78495975 TGAAAACAGCTTGGAGAGAAAGG - Intergenic
1163673806 19:18645214-18645236 TCTAGACTCCTTGGAGGGAAAGG + Intronic
1164769031 19:30793895-30793917 ATTAAACTGCTTGGGGGAAAAGG + Intergenic
1165213078 19:34251011-34251033 TCTAAAATGCTTGGTGGGATCGG - Intergenic
1168525289 19:57083804-57083826 TGGAAACTGCTTTGAGGCTATGG + Intergenic
928291183 2:30038639-30038661 TGTGAGCTGTTTGAAGGGAAGGG + Intergenic
929038283 2:37718274-37718296 TGTAAACTGCTGGTTGGCAATGG - Intronic
929910887 2:46088649-46088671 TGTAAATTGCTTTGAGGATAGGG - Intronic
930263443 2:49172893-49172915 TTTTAACTGCTTTGAGAGAAGGG + Intergenic
930843318 2:55872395-55872417 TGTAAACTCCTTGAGGGCAAGGG + Intronic
931479404 2:62625032-62625054 TTTAAACTGCTTGGTGAGAGAGG + Intergenic
932276409 2:70455143-70455165 TGGATACTGCTTGGTGGGGAGGG + Intronic
932387292 2:71347363-71347385 TGCAAAATGATTGGAGGGAAGGG + Intronic
933260625 2:80127454-80127476 TGTTAGATGGTTGGAGGGAAAGG - Intronic
934864822 2:97798303-97798325 TGTAAACTTTTTTGAGGGAAGGG + Intronic
935674515 2:105582822-105582844 TGTTAAGTGCTTCCAGGGAAGGG + Intergenic
940271566 2:151896633-151896655 TGTGAACTGATTGGAGAGGAAGG - Intronic
940378060 2:152979946-152979968 TGTACACTGATTGGAGAAAAGGG - Intergenic
942025818 2:171909401-171909423 TGGAATCTGCCTGGGGGGAAAGG + Intronic
943449652 2:188032413-188032435 TGTAAAGGGCTGGGGGGGAAGGG - Intergenic
943908843 2:193536843-193536865 TGGAAACTGCTCCGAGGAAAGGG - Intergenic
945545714 2:211148809-211148831 TGTAAATTGGTGGGTGGGAAAGG - Intergenic
945655571 2:212618938-212618960 TGTAAGCTGCTTGGAAGGACAGG - Intergenic
946072659 2:217047742-217047764 TGTAAACAGTGTGGTGGGAAGGG - Intergenic
946129879 2:217598457-217598479 TGTAAAATGCTTGGACAGGAAGG - Intronic
946681366 2:222220294-222220316 TGTACAGTGCTTGGAGGAAGCGG + Exonic
946863167 2:224019410-224019432 TGTAAACTGCAAGGAGGACAGGG - Intronic
947098685 2:226595101-226595123 GGTAAAGTGCTTGTAGGCAATGG - Intergenic
947917428 2:233842425-233842447 TCTAAACAGCCTAGAGGGAAAGG - Intronic
1169623252 20:7532011-7532033 AGTAAATTGATTGGAGAGAAAGG + Intergenic
1169789993 20:9399747-9399769 TGTAAACCACTTGAAGGCAAGGG - Intronic
1170331419 20:15214983-15215005 TTTAAACTGCTTGGACCAAAAGG - Intronic
1173639254 20:44588236-44588258 TGTAAACTTCATGCAGGTAAAGG - Intronic
1174092159 20:48058210-48058232 GGGAAAGTGCTTGGAGGGACGGG + Intergenic
1174137140 20:48387364-48387386 TGTACACTCCTTGGAGGTGATGG + Intergenic
1179133399 21:38659497-38659519 TCTAAACTACTTGGAGAGAATGG + Intronic
1179524207 21:41965281-41965303 TGTAAACTGCATGGGTGGCAGGG + Intergenic
1179593981 21:42430134-42430156 TGGAAACTACTGGGAAGGAAGGG - Intronic
1183395676 22:37569466-37569488 TCTAAACTCCCTGGAGGGGAGGG - Intergenic
952667747 3:35927607-35927629 TGCAAACTGCAAGGTGGGAAAGG - Intergenic
952855877 3:37770523-37770545 GATAAACGGCTTGGAGGAAATGG - Intronic
954913147 3:54125487-54125509 TGTAATCTGATGCGAGGGAAAGG + Intronic
955973592 3:64460233-64460255 TGGAGATTGCTTGGAGGGAAAGG - Intergenic
956615402 3:71166215-71166237 TGTAAGCTCCTTGAAGGCAAGGG - Intronic
957244841 3:77703570-77703592 TGTAACCTGCTTCAAGGGAAAGG + Intergenic
958899129 3:99864876-99864898 TGTAAACTACATGCAGGTAATGG + Intronic
959112198 3:102135020-102135042 TGTAAGCTTCTTGAAGGAAAAGG + Intronic
961490693 3:127255092-127255114 TGTAAACTGTACCGAGGGAAAGG - Intergenic
961560686 3:127726956-127726978 TGTAAAATACTTGGAGACAATGG - Intronic
962234301 3:133694281-133694303 TGTCAACTGTGTGCAGGGAAAGG + Intergenic
962611165 3:137077476-137077498 TTCAAAGAGCTTGGAGGGAATGG - Intergenic
962926118 3:139994846-139994868 TGTAAACTCCTTAGTGGCAAAGG - Intronic
963638895 3:147834988-147835010 TGTAAATTGCTTTGAGAGTATGG + Intergenic
965177690 3:165356809-165356831 TGTAAACTGCTTGGTGAGTATGG + Intergenic
965669979 3:171137551-171137573 TAAAAACTGCTTGGATGGGAGGG - Intronic
966538515 3:181062829-181062851 TGTAAACTTCTTTGAGGGTCTGG + Intergenic
967011702 3:185441428-185441450 TGTAAGCTCCTTGAAGGGAAAGG - Intronic
967190947 3:186984510-186984532 TGTGCACTGGTTGGAAGGAAAGG - Intronic
970015579 4:11508719-11508741 TGTAAGCTGCATGAAGGCAAGGG - Intergenic
970691085 4:18621481-18621503 TCTAAATTGGTAGGAGGGAAAGG - Intergenic
972836230 4:42873333-42873355 TGTAAACTGCTTTGTAGAAATGG - Intergenic
973156859 4:46965921-46965943 TGTAAACTGATGGGTGGTAAAGG - Intronic
976354732 4:84103949-84103971 TGGAAACAGCATGCAGGGAAAGG + Intergenic
976659973 4:87530561-87530583 TGTAAACTCCTTGAAGGAAGGGG + Intronic
976808946 4:89079433-89079455 TATAAAGTGCTTTGAAGGAAGGG + Intronic
977132906 4:93265792-93265814 TTTGAACTGCATGGTGGGAAGGG - Intronic
979167381 4:117552838-117552860 TGTAAACTTCTTGAAGAAAAAGG + Intergenic
980836760 4:138203507-138203529 ATTAAACTGCTTAGAGGAAAAGG - Intronic
982313208 4:154006537-154006559 TGAGAACTGCCAGGAGGGAATGG + Intergenic
982741417 4:159061149-159061171 GGTAAACAAATTGGAGGGAAAGG + Intergenic
983321356 4:166199933-166199955 TGTAAACTGCCTGGGGTTAAAGG + Intergenic
983502678 4:168517478-168517500 TGTAAACTAATTGGAGGCATTGG - Intronic
985964413 5:3329051-3329073 TGCACACTGCTTGGAGGGTTAGG - Intergenic
987517480 5:18931870-18931892 TGTAAACTGCCTGCAGAGCATGG - Intergenic
988809914 5:34774683-34774705 TGTAGACTGCTTGGATAGTATGG - Intronic
992515063 5:77483005-77483027 TGGAAACTGCTGGTAGAGAAGGG - Intronic
992893883 5:81230658-81230680 GGGAAACTGCGTTGAGGGAAGGG + Intergenic
994797940 5:104330602-104330624 TGTGACCTGCCTGGATGGAATGG + Intergenic
997911539 5:137878904-137878926 TGTGGACTTTTTGGAGGGAATGG - Intronic
998729309 5:145056111-145056133 TATAAAGTGCTTGAGGGGAATGG - Intergenic
999511373 5:152256146-152256168 TGGGAACTCCTTGGAAGGAAAGG + Intergenic
999793577 5:154966444-154966466 TGTAAACTGCTTGGAGGCAGGGG + Intronic
1000213536 5:159132575-159132597 TGTAAACTGCACAGAGAGAAAGG + Intergenic
1000724114 5:164747091-164747113 TGTAATTTGTTTGGAGGAAAGGG - Intergenic
1000953591 5:167515040-167515062 TGTAAACTGCATGTATGGAAAGG + Intronic
1001633043 5:173190821-173190843 TGTAAAAAACCTGGAGGGAATGG + Intergenic
1001703207 5:173722309-173722331 TGATAAGTGCTGGGAGGGAAAGG + Intergenic
1002875370 6:1204916-1204938 TGTAACCTGATTGGAGTTAAAGG - Intergenic
1003777935 6:9390245-9390267 TGAATAATACTTGGAGGGAAAGG + Intergenic
1005711405 6:28506356-28506378 TCCAAACTGGTTGCAGGGAAAGG + Exonic
1007256354 6:40531943-40531965 TGTGAACATCTTGGAGGCAAGGG + Intronic
1007759557 6:44125850-44125872 GGTAAAGTGCTTGGTGGGAAGGG - Intronic
1008145114 6:47881907-47881929 TGTAAACTGCATTTAGGAAAAGG + Intronic
1011819473 6:91234685-91234707 TGTAATATCCTTGGAGTGAAAGG - Intergenic
1017581875 6:155873854-155873876 AATAAAATGCTTCGAGGGAAGGG - Intergenic
1017691369 6:156968896-156968918 TGCTAGCTGCTTGGAGTGAAGGG + Intronic
1017810318 6:157979668-157979690 TGTATAATGCCTGGAGGGTAGGG - Intergenic
1018320051 6:162598939-162598961 TGTAATTTGTCTGGAGGGAAGGG - Intronic
1021976673 7:26018037-26018059 TGTGTACTGGTGGGAGGGAAGGG - Intergenic
1022191915 7:28024807-28024829 TATAAACTCCTTGAAGGAAAAGG - Intronic
1023634849 7:42199464-42199486 TGTAACCTGCTTGGTGAGACAGG - Intronic
1028475533 7:91249278-91249300 TGTTAACAGCTTGGAGAGGAGGG - Intergenic
1028707291 7:93864817-93864839 TAGAAAGTTCTTGGAGGGAAGGG + Intronic
1029055522 7:97736959-97736981 TATAAACTCCTTAGAGAGAAAGG + Intronic
1029393522 7:100290990-100291012 TGAAAACAGCATGGAGGGGATGG - Intergenic
1029954316 7:104621577-104621599 TGTCAACTCCCTGGAGGGAAAGG - Intronic
1034308109 7:150062846-150062868 TGAAAGCTGCTAGGAGGTAATGG - Intergenic
1034798744 7:154037825-154037847 TGAAAGCTGCTAGGAGGTAATGG + Intronic
1034970012 7:155413019-155413041 TGCAAACTCCTCAGAGGGAATGG - Intergenic
1037018619 8:13940452-13940474 TGTTAAAGGCATGGAGGGAAGGG + Intergenic
1039028318 8:33282431-33282453 AGTAAACTGATAGGAGGCAAGGG - Intergenic
1040748998 8:50682667-50682689 TGGAAACTGATAGGAGGCAAAGG - Intronic
1042450177 8:68936018-68936040 TAAAAACTGCTTGGTGGGCATGG - Intergenic
1042982597 8:74547272-74547294 AGTAAACTGCCTTGAGGAAATGG - Intergenic
1043685910 8:83086022-83086044 AGTTAACTGCTTGGTGGGTAGGG - Intergenic
1047897251 8:129380493-129380515 TGTTAACTGCTTGGTGGAAGAGG - Intergenic
1048390203 8:133955855-133955877 TGTAGACTACTTGAAGGGAAGGG - Intergenic
1050197046 9:3096328-3096350 TGTAAAATACATGGAAGGAAAGG - Intergenic
1051995511 9:23211545-23211567 TGAAAACAGCTTTAAGGGAATGG - Intergenic
1052194899 9:25700340-25700362 TGTCAACTCCTTGAAGGCAAGGG - Intergenic
1052512290 9:29437310-29437332 TGTAAACTACTTGGAGTGCCTGG + Intergenic
1056342213 9:85647627-85647649 TGTAAACTGCTTGGAGACAAGGG + Intronic
1058585026 9:106498399-106498421 GGAAGACTGCTTGGAGGGCATGG + Intergenic
1059237235 9:112771144-112771166 TGTAAACTTCTTGAAGGCAAGGG + Intronic
1059257881 9:112947425-112947447 GGGAAACTGATTTGAGGGAATGG + Intergenic
1059490714 9:114665126-114665148 TATAAACTGGATGTAGGGAAAGG + Intergenic
1059840596 9:118211073-118211095 TGTTAAGTGCTTGGAAGGAAGGG + Intergenic
1060419009 9:123454229-123454251 TATAAACTGATGGAAGGGAAAGG + Intronic
1060965949 9:127712403-127712425 TGGAAGCTGCTTGCAGAGAAGGG + Intronic
1187510177 X:19910533-19910555 TATGAACTGCTTGAAGAGAAAGG - Intergenic
1188615793 X:32157724-32157746 TGTGAGCTGCTCAGAGGGAAAGG - Intronic
1190280486 X:48926045-48926067 TGCAAACTGCAAGGAGGGAGAGG + Exonic
1190741673 X:53292850-53292872 TGTTCACTGCGTGCAGGGAAGGG + Intronic
1191611827 X:63124078-63124100 TATAAAGTGGTTGAAGGGAATGG + Intergenic
1192573703 X:72226292-72226314 CATACCCTGCTTGGAGGGAAGGG - Intronic
1193981157 X:88183526-88183548 TGTAAACTGCTTGGATAGTATGG + Intergenic
1194195919 X:90892730-90892752 TGGAATATGCATGGAGGGAAAGG - Intergenic
1194425740 X:93735371-93735393 TGTAAATTTCTTGGACAGAACGG + Intergenic
1195280630 X:103329785-103329807 TGAAACCAGATTGGAGGGAATGG - Intergenic
1196624996 X:117868305-117868327 TGAAAACTTCTTGGGAGGAATGG + Intergenic
1196811829 X:119635063-119635085 TGTTAAGGGCTGGGAGGGAATGG + Intronic
1198363324 X:135916941-135916963 TGTCACATGGTTGGAGGGAAAGG + Intergenic
1199510226 X:148613455-148613477 TGTAAAGGGCTTAGAGTGAAGGG - Intronic
1199592501 X:149480274-149480296 GGTAAACTACTTGGAAAGAAAGG + Intergenic
1200541767 Y:4466923-4466945 TGGAATATGCATGGAGGGAAAGG - Intergenic
1201217657 Y:11737153-11737175 TGTAAACTAATTGAAAGGAATGG + Intergenic