ID: 903319102

View in Genome Browser
Species Human (GRCh38)
Location 1:22531336-22531358
Sequence TTTCAGCTGTTCACCAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903319102_903319103 -8 Left 903319102 1:22531336-22531358 CCTTTCTTGGTGAACAGCTGAAA 0: 1
1: 0
2: 2
3: 10
4: 189
Right 903319103 1:22531351-22531373 AGCTGAAAATGTCACATTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 181
903319102_903319104 4 Left 903319102 1:22531336-22531358 CCTTTCTTGGTGAACAGCTGAAA 0: 1
1: 0
2: 2
3: 10
4: 189
Right 903319104 1:22531363-22531385 CACATTGCTGGCAGCCAACAAGG No data
903319102_903319108 29 Left 903319102 1:22531336-22531358 CCTTTCTTGGTGAACAGCTGAAA 0: 1
1: 0
2: 2
3: 10
4: 189
Right 903319108 1:22531388-22531410 ACAAGAGCAGGAGACCCGGATGG No data
903319102_903319105 17 Left 903319102 1:22531336-22531358 CCTTTCTTGGTGAACAGCTGAAA 0: 1
1: 0
2: 2
3: 10
4: 189
Right 903319105 1:22531376-22531398 GCCAACAAGGAAACAAGAGCAGG No data
903319102_903319107 25 Left 903319102 1:22531336-22531358 CCTTTCTTGGTGAACAGCTGAAA 0: 1
1: 0
2: 2
3: 10
4: 189
Right 903319107 1:22531384-22531406 GGAAACAAGAGCAGGAGACCCGG No data
903319102_903319109 30 Left 903319102 1:22531336-22531358 CCTTTCTTGGTGAACAGCTGAAA 0: 1
1: 0
2: 2
3: 10
4: 189
Right 903319109 1:22531389-22531411 CAAGAGCAGGAGACCCGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903319102 Original CRISPR TTTCAGCTGTTCACCAAGAA AGG (reversed) Intergenic