ID: 903319108

View in Genome Browser
Species Human (GRCh38)
Location 1:22531388-22531410
Sequence ACAAGAGCAGGAGACCCGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903319102_903319108 29 Left 903319102 1:22531336-22531358 CCTTTCTTGGTGAACAGCTGAAA 0: 1
1: 0
2: 2
3: 10
4: 189
Right 903319108 1:22531388-22531410 ACAAGAGCAGGAGACCCGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903319108 Original CRISPR ACAAGAGCAGGAGACCCGGA TGG Intergenic