ID: 903321998

View in Genome Browser
Species Human (GRCh38)
Location 1:22548779-22548801
Sequence TCTAGGCCTCCTCTGCAAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903321991_903321998 13 Left 903321991 1:22548743-22548765 CCTAGCCGTGTGACCCAGGGCAA No data
Right 903321998 1:22548779-22548801 TCTAGGCCTCCTCTGCAAAGCGG No data
903321993_903321998 0 Left 903321993 1:22548756-22548778 CCCAGGGCAACTGACCTCATCCT No data
Right 903321998 1:22548779-22548801 TCTAGGCCTCCTCTGCAAAGCGG No data
903321988_903321998 30 Left 903321988 1:22548726-22548748 CCATCTCTCTGCTGCTGCCTAGC No data
Right 903321998 1:22548779-22548801 TCTAGGCCTCCTCTGCAAAGCGG No data
903321992_903321998 8 Left 903321992 1:22548748-22548770 CCGTGTGACCCAGGGCAACTGAC No data
Right 903321998 1:22548779-22548801 TCTAGGCCTCCTCTGCAAAGCGG No data
903321994_903321998 -1 Left 903321994 1:22548757-22548779 CCAGGGCAACTGACCTCATCCTT No data
Right 903321998 1:22548779-22548801 TCTAGGCCTCCTCTGCAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903321998 Original CRISPR TCTAGGCCTCCTCTGCAAAG CGG Intergenic
No off target data available for this crispr