ID: 903323080

View in Genome Browser
Species Human (GRCh38)
Location 1:22554085-22554107
Sequence CAGATCATGGAGAAGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903323080_903323089 22 Left 903323080 1:22554085-22554107 CCTGGCTCCTTCTCCATGATCTG No data
Right 903323089 1:22554130-22554152 CAAGGTAGCAGCCAGAGCCCTGG No data
903323080_903323084 -3 Left 903323080 1:22554085-22554107 CCTGGCTCCTTCTCCATGATCTG No data
Right 903323084 1:22554105-22554127 CTGCTTGCTCCATGGTGAGATGG No data
903323080_903323085 4 Left 903323080 1:22554085-22554107 CCTGGCTCCTTCTCCATGATCTG No data
Right 903323085 1:22554112-22554134 CTCCATGGTGAGATGGCCCAAGG No data
903323080_903323090 28 Left 903323080 1:22554085-22554107 CCTGGCTCCTTCTCCATGATCTG No data
Right 903323090 1:22554136-22554158 AGCAGCCAGAGCCCTGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903323080 Original CRISPR CAGATCATGGAGAAGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr