ID: 903323084

View in Genome Browser
Species Human (GRCh38)
Location 1:22554105-22554127
Sequence CTGCTTGCTCCATGGTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903323080_903323084 -3 Left 903323080 1:22554085-22554107 CCTGGCTCCTTCTCCATGATCTG No data
Right 903323084 1:22554105-22554127 CTGCTTGCTCCATGGTGAGATGG No data
903323074_903323084 28 Left 903323074 1:22554054-22554076 CCCCGAGGCTGACAAGTGAACAG No data
Right 903323084 1:22554105-22554127 CTGCTTGCTCCATGGTGAGATGG No data
903323076_903323084 26 Left 903323076 1:22554056-22554078 CCGAGGCTGACAAGTGAACAGAC No data
Right 903323084 1:22554105-22554127 CTGCTTGCTCCATGGTGAGATGG No data
903323078_903323084 4 Left 903323078 1:22554078-22554100 CCCACAGCCTGGCTCCTTCTCCA No data
Right 903323084 1:22554105-22554127 CTGCTTGCTCCATGGTGAGATGG No data
903323081_903323084 -10 Left 903323081 1:22554092-22554114 CCTTCTCCATGATCTGCTTGCTC No data
Right 903323084 1:22554105-22554127 CTGCTTGCTCCATGGTGAGATGG No data
903323075_903323084 27 Left 903323075 1:22554055-22554077 CCCGAGGCTGACAAGTGAACAGA No data
Right 903323084 1:22554105-22554127 CTGCTTGCTCCATGGTGAGATGG No data
903323073_903323084 29 Left 903323073 1:22554053-22554075 CCCCCGAGGCTGACAAGTGAACA No data
Right 903323084 1:22554105-22554127 CTGCTTGCTCCATGGTGAGATGG No data
903323079_903323084 3 Left 903323079 1:22554079-22554101 CCACAGCCTGGCTCCTTCTCCAT No data
Right 903323084 1:22554105-22554127 CTGCTTGCTCCATGGTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903323084 Original CRISPR CTGCTTGCTCCATGGTGAGA TGG Intergenic
No off target data available for this crispr